Molecular/Barcoding Data

This page is an in-development cooperative work with SCOR WG157 (MetaZooGene, MetaZooGene.org).   The "MZG" plots and information tables below summarize known observations of this taxa (Temoridae) and locations associated with GenBank barcodes for this taxa or taxa group (red stars).   Additional information on this taxa is available at  https://copepedia.org/?id=T4001910

Map Views:   [   World   |   Arctic   |   NATL   |   Baltic   |   Mediterranean   |   SATL   |   NPAC   |   SPAC   |   Indian Ocean   |   Southern   ]



In the map above, light blue circles indicate where this taxa has been observed in COPEPOD or OBIS.
Red stars indicate locations where genus-level or species-level barcoding samples exist in GenBank or BOLD.




The table below shows the values plotted in the bargraph above.   Ocean columns indicate taxa has been observed in that ocean.

Sibling-taxa of this
Family
# of Species
Observed in
COPEPOD/OBIS
# of Species
barcoded in
GenBank/BOLD
# of these
barcoded-species
with GeoLocation
Epischura420
Eurytemora181310
Heterocope321
Temora444
GRAND TOTAL292115







The Primer data below are a collaborative contribution of the ICES Working Group on Integrated Morphologocial and Molecular Taxonomy (WGIMT).

You can also download a CSV version of this compilation file (click here).

NOTE:   No primer data are currently available for this taxa level, but sibling primer data exist (below).

Sibling PRIMERS:   Below are primer data from any taxonomic-siblings of the current taxa.

Sibling Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Eurytemora (T4000082) Mitochondrial 16S 16SA2 Forward CCGGGT(CT)TCGCTAAGGTAG Lee 2000 (L000106) ... 16SB2 WGIMT-compilation 2016
Crustacea : Copepoda : Eurytemora (T4000082) Mitochondrial 16S 16SB2 Reverse CAACATCGAGGTCGCAGTAA Lee 2000 (L000106) ... 16SA2 WGIMT-compilation 2016

Last Updated:   2020-Nov-13