NOTE:   No primer data are currently available for this taxa level, but sibling primer data exist (below).

Sibling PRIMERS:   Below are primer data from any taxonomic-siblings of the current taxa.

Sibling Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16S-167 Forward GACGAGAAGACCCTATGAAG Bucklin et al. 1998 (L000087) ... 16sbr-H WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16sbr-H Reverse CCGGTTTGAACTCAGATCATGT Palumbi 1996 (L000114) ... 16S-167 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 IST-5 Forward GGAAGTAAAAGTCGTAACAAGG White et al. 1990 (L000123) ... ITS-4 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 ITS-4 Reverse TCCTCCGCTTATTGATATGC White et al. 1990 (L000123) ... IST-5 WGIMT-compilation 2016