Molecular/Barcoding Data

This page is an in-development cooperative work with SCOR WG157 (MetaZooGene, MetaZooGene.org).   The "MZG" plots and information tables below summarize known observations of this taxa (Acartiidae) and locations associated with GenBank barcodes for this taxa or taxa group (red stars).   Additional information on this taxa is available at  https://copepedia.org/?id=T4001907



In the map above, light blue circles indicate where this taxa has been observed in COPEPOD or OBIS.
Red stars indicate locations where genus-level or species-level barcoding samples exist in GenBank or BOLD.




The table below shows the values plotted in the bargraph above.

Sibling-taxa of this
Family
# of Species
Observed in
COPEPOD/OBIS
# of Species
barcoded in
GenBank/BOLD
# of these
barcoded-species
with GeoLocation
Acartia352614
Paracartia220
Paralabidocera100
GRAND TOTAL382814




The table below provides species-level obs-and-barcode-counts information sorted by taxonomic hierarchy.
Not all barcodes have geo-location, and repeating same-location/duplicate-location barcodes visibly may show up as a single star on the map.

Species and Taxonomic-Rankings# unique obs
in COPEPOD
# of
Barcodes
# of Barcodes
with GeoLoc
~ # of
BC-Stars
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) bifilosa70081671
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) bilobata0100
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) californiensis138101
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) fossae142992
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) levequei0100
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) sinjiensis32no-barcodesno-barcodesno-barcodes
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) spinata40no-barcodesno-barcodesno-barcodes
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) steueri3300
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) tonsa331337617916
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) tsuensis0800
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acanthacartia) : Acartia (Acanthacartia) tumida337no-barcodesno-barcodesno-barcodes
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartia) : Acartia (Acartia) danae21656200
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartia) : Acartia (Acartia) negligens2525800
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartiura) : Acartia (Acartiura) clausi1253855257
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartiura) : Acartia (Acartiura) ensifera98331
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartiura) : Acartia (Acartiura) hongi291no-barcodesno-barcodesno-barcodes
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartiura) : Acartia (Acartiura) jilletti18111
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartiura) : Acartia (Acartiura) longiremis1668713013012
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartiura) : Acartia (Acartiura) omorii643200
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartiura) : Acartia (Acartiura) simplex92no-barcodesno-barcodesno-barcodes
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartiura) : Acartia (Acartiura) tranteri1167no-barcodesno-barcodesno-barcodes
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartiura) hudsonica36468619
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Acartiura) margalefi2700
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Euacartia) : Acartia (Euacartia) forticrusa0600
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Euacartia) : Acartia (Euacartia) southwelli11400
Copepoda : Calanoida : Acartiidae : Acartia : Acartia grani0no-barcodesno-barcodesno-barcodes
Copepoda : Calanoida : Acartiidae : Acartia : Acartia latisetosa1no-barcodesno-barcodesno-barcodes
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Odontacartia) : Acartia (Odontacartia) amboinensis132221
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Odontacartia) : Acartia (Odontacartia) australis206no-barcodesno-barcodesno-barcodes
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Odontacartia) : Acartia (Odontacartia) bispinosa13500
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Odontacartia) : Acartia (Odontacartia) erythraea1098511
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Odontacartia) : Acartia (Odontacartia) lilljeborgi429no-barcodesno-barcodesno-barcodes
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Odontacartia) : Acartia (Odontacartia) ohtsukai51761
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Odontacartia) : Acartia (Odontacartia) spinicauda79300
Copepoda : Calanoida : Acartiidae : Acartia : Acartia (Odontacartia) : Acartia pacifica5931561
Copepoda : Calanoida : Acartiidae : Acartia : Mitrella hernandezi2071011
Copepoda : Calanoida : Acartiidae : Paracartia : Paracartia grani21100
Copepoda : Calanoida : Acartiidae : Paracartia : Paracartia latisetosa36800
Copepoda : Calanoida : Acartiidae : Paralabidocera : Paralabidocera antarctica15159no-barcodesno-barcodesno-barcodes









The Primer data below are a collaborative contribution of the ICES Working Group on Integrated Morphologocial and Molecular Taxonomy (WGIMT).

You can also download a CSV version of this compilation file (click here).

NOTE:   No primer data are currently available for this taxa level, but sibling primer data exist (below).

Sibling PRIMERS:   Below are primer data from any taxonomic-siblings of the current taxa.

Sibling Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16S-167 Forward GACGAGAAGACCCTATGAAG Bucklin et al. 1998 (L000087) ... 16sbr-H WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16sbr-H Reverse CCGGTTTGAACTCAGATCATGT Palumbi 1996 (L000114) ... 16S-167 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 IST-5 Forward GGAAGTAAAAGTCGTAACAAGG White et al. 1990 (L000123) ... ITS-4 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 ITS-4 Reverse TCCTCCGCTTATTGATATGC White et al. 1990 (L000123) ... IST-5 WGIMT-compilation 2016

Last Updated:   2019-Oct-10