Molecular/Barcoding Data

This page is an in-development cooperative work with SCOR WG157 (MetaZooGene, MetaZooGene.org).   The "MZG" plots and information tables below summarize known observations of this taxa (Pareucalanus) and locations associated with GenBank barcodes for this taxa or taxa group (red stars).   Additional information on this taxa is available at  https://copepedia.org/?id=T4001906

Map Views:   [   World   |   NATL   |   Mediterranean   |   SATL   |   NPAC   |   SPAC   |   Indian Ocean   |   Southern   ]



In the map above, light blue circles indicate where this taxa has been observed in COPEPOD or OBIS.
Red stars indicate locations where genus-level or species-level barcoding samples exist in GenBank or BOLD.




The table below shows the values plotted in the bargraph above.   Ocean columns indicate taxa has been observed in that ocean.

Sibling-taxa of this Genus	# of Species Observed in COPEPOD/OBIS	# of Species barcoded in GenBank/BOLD	# of these barcoded-species with GeoLocation
Pareucalanus attenuatus	1	1	1
Pareucalanus langae	1	1	0
Pareucalanus parki	1	1	0
Pareucalanus sewelli	1	1	1
GRAND TOTAL	4	4	2

The Primer data below are a collaborative contribution of the ICES Working Group on Integrated Morphologocial and Molecular Taxonomy (WGIMT).

You can also download a CSV version of this compilation file (click here).

Self PRIMERS:   Below are primers available for the current taxa entity (Pareucalanus).

Taxonomic Entity	Marker	Primer Name	Direction	Sequence ( 5' - 3' )	Reference	Primer Pairings	Annealing T	Compilation
Crustacea : Copepoda : Pareucalanus (T4001906)	Mitochondrial 16S	16S_PAR1		GCTAAGGTAGCATAATAATTAGTT	Goetze 2003 (L000099) ...			WGIMT-compilation 2016

Last Updated:   2020-Nov-11