Molecular/Barcoding Data

This page is an in-development cooperative work with SCOR WG157 (MetaZooGene, MetaZooGene.org).   The "MZG" plots and information tables below summarize known observations of this taxa (Eucalanidae) and locations associated with GenBank barcodes for this taxa or taxa group (red stars).   Additional information on this taxa is available at  https://copepedia.org/?id=T4000361

Map Views:   [   World   |   Arctic   |   NATL   |   Mediterranean   |   SATL   |   NPAC   |   SPAC   |   Indian Ocean   |   Southern   ]



In the map above, light blue circles indicate where this taxa has been observed in COPEPOD or OBIS.
Red stars indicate locations where genus-level or species-level barcoding samples exist in GenBank or BOLD.




The table below shows the values plotted in the bargraph above.   Ocean columns indicate taxa has been observed in that ocean.

Sibling-taxa of this
Family
# of Species
Observed in
COPEPOD/OBIS
# of Species
barcoded in
GenBank/BOLD
# of these
barcoded-species
with GeoLocation
Eucalanus641
Pareucalanus442
GRAND TOTAL1083







The Primer data below are a collaborative contribution of the ICES Working Group on Integrated Morphologocial and Molecular Taxonomy (WGIMT).

You can also download a CSV version of this compilation file (click here).

Self PRIMERS:   Below are primers available for the current taxa entity (Eucalanidae).

Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial 16S 16SAR Forward CGCCTGTTTATCAAAAACAT Braga et al. 1999 (L000086) ... 16SCB WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial 16S 16SCB Reverse ATTCAACATCGAGGTCACAA Braga et al. 1999 (L000086) ... 16SAR WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial COI COI_RNI Forward GTAGT(AGCT)GTAAC(AT)GCTCATGC Goetze and Bradford-Grieve 2005 (L000101) ... COI_VH WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Nuclear ITS2 ITS10R Reverse TACGGGCCTATCACCCTCTACG Geerken and Wyngaard unpubl. Data in Goetze 2003 (L999999) ... ITS3F WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Nuclear ITS2 ITS3F Forward GCATCGATGAAGAACGCAGC White et al. 1990 (L000123) ... ITS10R WGIMT-compilation 2016

Sibling PRIMERS:   Below are primer data from any taxonomic-siblings of the current taxa.

Sibling Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Pareucalanus (T4001906) Mitochondrial 16S 16S_PAR1 GCTAAGGTAGCATAATAATTAGTT Goetze 2003 (L000099) ... WGIMT-compilation 2016

Last Updated:   2020-Nov-11