NOTE:   No primer data are currently available for this taxa level, but sibling primer data exist (below).

Sibling PRIMERS:   Below are primer data from any taxonomic-siblings of the current taxa.

Sibling Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Mesocyclops (T4003568) Nuclear 18S 18s329 Forward TAATGATCCTTCCGCAGGTT Spears et al. 1992 (L000119) ... 18sI- WGIMT-compilation 2016
Crustacea : Copepoda : Mesocyclops (T4003568) Nuclear 18S 18sI- Reverse AACT(CT)AAAGGAATTGACGG Spears et al. 1992 (L000119) ... 18s329 WGIMT-compilation 2016