Molecular/Barcoding Data

This page is an in-development cooperative work with SCOR WG157 (MetaZooGene, MetaZooGene.org).   The "MZG" plots and information tables below summarize known observations of this taxa (Cyclopoida) and locations associated with GenBank barcodes for this taxa or taxa group (red stars).   Additional information on this taxa is available at  https://copepedia.org/?id=T4000232



In the map above, light blue circles indicate where this taxa has been observed in COPEPOD or OBIS.
Red stars indicate locations where genus-level or species-level barcoding samples exist in GenBank or BOLD.




The table below shows the values plotted in the bargraph above.

Sibling-taxa of this
Order
# of Species
Observed in
COPEPOD/OBIS
# of Species
barcoded in
GenBank/BOLD
# of these
barcoded-species
with GeoLocation
Cyclopida1316342
Cyclopoida incertae sedis610
Ergasilida10598928
Oithonida1231912
GRAND TOTAL131917282




The table below provides species-level obs-and-barcode-counts information sorted by taxonomic hierarchy.
Not all barcodes have geo-location, and repeating same-location/duplicate-location barcodes visibly may show up as a single star on the map.

Species and Taxonomic-Rankings# unique obs
in COPEPOD
# of
Barcodes
# of Barcodes
with GeoLoc
~ # of
BC-Stars
Crustacea - Copepoda : Cyclopoida : Abrsiidae : Abrsia : Abrsia misophrioides
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Allopodion : Allopodion mirum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Amarda : Amarda curvus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Amarda : Amarda goniastreae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Amardopsis : Amardopsis merulinae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus abbreviatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus angustus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus breviarius
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus compressus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus conformatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus contractus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus convexus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus digitatus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus eparmatoides
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus exsertus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus gibberulus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus gigas
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus gracilipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus gratus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus hastatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus latens
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus maximus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus mimeticus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus moluccanus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus multidentatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus nasutus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus notatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus noumensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus orectus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus pandus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus parangensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus partenuipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus prolixipes
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus punctilis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus setellus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus tanaus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus tenuipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Anchimolgus : Anchimolgus tridentatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Cerioxynus : Cerioxynus alatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Cerioxynus : Cerioxynus bandensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Cerioxynus : Cerioxynus faviticolus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Cerioxynus : Cerioxynus moluccensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Cerioxynus : Cerioxynus montastreae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Cerioxynus : Cerioxynus oulophylliae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Dumbeana : Dumbeana undulatipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Ecphysarion : Ecphysarion ampullulum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Ecphysarion : Ecphysarion lobophorum
(no barcodes)
15000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Euxynus : Euxynus capulus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Exodontomolgus : Exodontomolgus communis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Haplomolgus : Haplomolgus incolumis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Haplomolgus : Haplomolgus montiporae
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Haplomolgus : Haplomolgus subdeficiens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Jamescookina : Jamescookina exigua
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Jamescookina : Jamescookina moluccensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Jamescookina : Jamescookina palmata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Jamescookina : Jamescookina redacta
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Juxtandrianellus : Juxtandrianellus probus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Karanges : Karanges galaxeanus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Karanges : Karanges hypsorophus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Kawanolus : Kawanolus parangensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Lipochaetes : Lipochaetes extrusus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Mycoxynus : Mycoxynus fungianus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Mycoxynus : Mycoxynus longicauda
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Mycoxynus : Mycoxynus villosus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus actinophorus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus bulbalis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus campulus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus decens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus exilipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus flammeus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus forhani
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus fultus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus geminus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus mucosus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus mundulus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus parvus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus pavonus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus pumilus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus rhadinus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus scitulus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Odontomolgus : Odontomolgus unioviger
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus auriculatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus bidentis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus directus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus eumeces
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus fastigatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus hydnophorae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus iratus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus necopinus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus parvipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus platygyrae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Panjakus : Panjakus saccipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Paraclamocus : Paraclamocus hiulcus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Paramarda : Paramarda aculeata
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Paranchimolgus : Paranchimolgus parallelus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Parandrianellus : Parandrianellus annulatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Prionomolgus : Prionomolgus lanceolatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Rakotoa : Rakotoa ceramensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Schedomolgus : Schedomolgus arcuatipes
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Schedomolgus : Schedomolgus dumbensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Schedomolgus : Schedomolgus exiliculus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Schedomolgus : Schedomolgus idanus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Schedomolgus : Schedomolgus insignellus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Schedomolgus : Schedomolgus majusculus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Schedomolgus : Schedomolgus tener
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Schedomolgus : Schedomolgus tenuicaudatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Schedomolgus : Schedomolgus walteri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger aristoides
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger concavipes
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger eumorphus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger humesi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger karangmiensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger latus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger longicaudatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger manifestus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger paucisurculus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger pennatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger pilosus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger placidus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger tenuatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Scyphuliger : Scyphuliger vicinus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Sociellus : Sociellus geminus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anchimolgidae : Sociellus : Sociellus torus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Antheacheridae : Staurosoma : Staurosoma parasiticum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius alatus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius amicalis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius brevicauda
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius concinnus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius discipedatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius distensus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius dolabellae
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius kimjensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius longipedis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius pinctadae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Anthessius : Anthessius stylocheili
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Anthessiidae : Katanthessius : Katanthessius stocki
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Archinotodelphyidae : Archinotodelphys : Archinotodelphys typicus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Archinotodelphyidae : Pararchinotodelphys : Pararchinotodelphys gurneyi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Archinotodelphyidae : Pararchinotodelphys : Pararchinotodelphys phallusiae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Ascidiocolidae : Ascidicola : Ascidicola rosea
(no barcodes)
20000
Crustacea - Copepoda : Cyclopoida : Ascidiocolidae : Styelicola : Styelicola bahusia
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Acanthocolax : Acanthocolax exilipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Acanthocolax : Acanthocolax similis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Acantholochus : Acantholochus australiensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Acantholochus : Acantholochus divaricatus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Acantholochus : Acantholochus nasus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Acantholochus : Acantholochus nudiusculus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Bomolochus : Bomolochus bellones
6100
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Bomolochus : Bomolochus constrictus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Bomolochus : Bomolochus cuneatus
0100
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Bomolochus : Bomolochus decapteri
1100
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Bomolochus : Bomolochus megaceros
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Bomolochus : Bomolochus nitidus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Bomolochus : Bomolochus paucus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Bomolochus : Bomolochus sinensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Ceratocolax : Ceratocolax euthynni
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Ceratocolax : Ceratocolax mykternastes
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Cresseyus : Cresseyus longicaudus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Cresseyus : Cresseyus palleucus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Dicrobomolochus : Dicrobomolochus eminens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Hamaticolax : Hamaticolax attenuatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Hamaticolax : Hamaticolax prolixus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Hamaticolax : Hamaticolax scutigerulus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Hamaticolax : Hamaticolax unisagittatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Holobomolochus : Holobomolochus acutus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Holobomolochus : Holobomolochus chilensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Holobomolochus : Holobomolochus glyphisodontis
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Holobomolochus : Holobomolochus vervoorti
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Holocolax : Holocolax longisetus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Holocolax : Holocolax nemipteri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Naricolax : Naricolax chrysophryenus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Naricolax : Naricolax stocki
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Nothobomolochus : Nothobomolochus chilensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Nothobomolochus : Nothobomolochus denticulatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Nothobomolochus : Nothobomolochus digitatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Nothobomolochus : Nothobomolochus kanagurta
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Nothobomolochus : Nothobomolochus pulicatensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Nothobomolochus : Nothobomolochus saetiger
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Nothobomolochus : Nothobomolochus teres
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Nothobomolochus : Nothobomolochus thambus
0100
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Nothobomolochus : Nothobomolochus triceros
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Orbitacolax : Orbitacolax aculeatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Orbitacolax : Orbitacolax hapalogenyos
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Pseudoeucanthus : Pseudoeucanthus australiensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Pseudorbitacolax : Pseudorbitacolax fimbriatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Pseudorbitacolax : Pseudorbitacolax varunae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Pumiliopes : Pumiliopes jonesi
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Pumiliopsis : Pumiliopsis sardinellae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Unicolax : Unicolax ciliatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Unicolax : Unicolax mycterobius
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Bomoochidae : Unicolax : Unicolax reductus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Botryllophilus : Botryllophilus bamfieldensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Botryllophilus : Botryllophilus ruber
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplosaccus : Haplosaccus elongatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostoma : Haplostoma albicatum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostoma : Haplostoma ambiguum
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostoma : Haplostoma brevicauda
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostoma : Haplostoma dentatum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostoma : Haplostoma dudleyae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostoma : Haplostoma elegans
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostoma : Haplostoma humesi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostoma : Haplostoma minutum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostoma : Haplostoma setiferum
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostomella : Haplostomella distincta
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostomella : Haplostomella dubia
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostomella : Haplostomella oceanica
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostomella : Haplostomella reducta
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostomides : Haplostomides bellus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostomides : Haplostomides hawaiiensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Haplostomides : Haplostomides luteolus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Paulillgia : Paulillgia polycarpae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Botryllophilidae : Schizoproctus : Schizoproctus inflatus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Buproridae : Buprorus : Buprorus caudatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Catiniidae : Cotylomolgus : Cotylomolgus lepidonoti
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Catiniidae : Myzomolgus : Myzomolgus orientalis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Catiniidae : Myzomolgus : Myzomolgus tenuis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chitonophilidae : Ischnochitonika : Ischnochitonika lasalliana
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthocanthopsis : Acanthocanthopsis chilomycteri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthocanthopsis : Acanthocanthopsis quadrata
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria alatalongicollis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria clavata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria cornuta
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria elongata
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria epachthes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria fraseri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria galerita
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria kajika
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria platycephali
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria rectangularis
0111
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria sixteni
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria soleae
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria spirigera
0100
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria tasmaniae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria tchangi
0100
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Acanthochondria : Acanthochondria triangularis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Bereacanthus : Bereacanthus clava
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Blias : Blias prionoti
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Bobkabata : Bobkabata kabatabobbus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Brachiochondria : Brachiochondria murtii
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Brachiochondria : Brachiochondria pinguis
0100
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthodes : Chondracanthodes deflexus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthodes : Chondracanthodes radiatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus australis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus barnardi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus colligens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus cottunculi
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus distortus
3100
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus goldsmidi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus gracilis
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus heterostichi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus irregularis
6111
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus lepophidii
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus lophii
2661
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus merluccii
8552
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus neali
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus nodosus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus tuberculatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Chondracanthus : Chondracanthus zei
2100
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Diocus : Diocus lycenchelus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Heterochondria : Heterochondria crassicornis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Heterochondria : Heterochondria longa
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Lateracanthus : Lateracanthus quadripedis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Lernaeosolea : Lernaeosolea lycodis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Lernentoma : Lernentoma asellina
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Medesicaste : Medesicaste penetrans
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Pharodes : Pharodes tortugensis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Protochondracanthus : Protochondracanthus alatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Protochondria : Protochondria longicauda
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Pseudochondracanthus : Pseudochondracanthus diceraus
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Pseudochondracanthus : Pseudochondracanthus hexaceraus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Rhynchochondria : Rhynchochondria longa
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chondracanthidae : Strabax : Strabax monstrosus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chordeumiidae : Lernaeosaccus : Lernaeosaccus ophiacanthae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Chordeumiidae : Ophioika : Ophioika tenuibrachia
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Clausidium : Clausidium caudatum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Clausidium : Clausidium dissimile
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Clausidium : Clausidium saldanhae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Conchyliurus : Conchyliurus bombasticus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Conchyliurus : Conchyliurus quintus
0100
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Foliomolgus : Foliomolgus cucullus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Giardella : Giardella callianassae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Giardella : Giardella carinifer
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Giardella : Giardella thompsoni
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Goodingius : Goodingius adhaerens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Goodingius : Goodingius subadhaerens
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemadona : Hemadona clavicrura
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops aberdonensis
(no barcodes)
13000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops acanthosquillae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops amplicaudatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops axiophilus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops biflagellatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops columnaris
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops ctenidis
1100
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops diremptus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops gomsoensis
2100
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops indicus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops intermedius
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops japonicus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops kombensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops leggii
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops nichollsi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops purpureus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops saxatilis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops tamilensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops tanakai
0100
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops thysanotus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops vicinalis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hemicyclops : Hemicyclops visendus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hersiliodes : Hersiliodes latericia
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hippomolgus : Hippomolgus cognatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hippomolgus : Hippomolgus latipes
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hyphalion : Hyphalion captans
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hyphalion : Hyphalion sagamiense
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Hyphalion : Hyphalion tertium
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Leptinogaster : Leptinogaster major
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Pseudopsyllus : Pseudopsyllus elongatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausidiidae : Saphirella : Saphirella tropica
(no barcodes)
47000
Crustacea - Copepoda : Cyclopoida : Clausiidae : Clausia : Clausia antiqua
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausiidae : Clausia : Clausia lubbockii
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Clausiidae : Likroclausia : Likroclausia namhaensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausiidae : Mesnilia : Mesnilia cluthae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausiidae : Rhodinicola : Rhodinicola elongata
(no barcodes)
16000
Crustacea - Copepoda : Cyclopoida : Clausiidae : Rhodinicola : Rhodinicola gibbosa
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausiidae : Rhodinicola : Rhodinicola laticauda
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Clausiidae : Rhodinicola : Rhodinicola rugosa
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Agetus : Agetus flaccus
(no barcodes)
421000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Agetus : Agetus limbatus
(no barcodes)
192000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Agetus : Agetus typicus
(no barcodes)
309000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus affinis
0300
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus africanus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus (Agetus) flaccus
(no barcodes)
314000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus (Agetus) limbatus
(no barcodes)
217000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus (Agetus) typicus
(no barcodes)
348000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus agilis
(no barcodes)
95000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus amazonicus
(no barcodes)
12000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus americanus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus andrewsi
(no barcodes)
13000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus anglicus
(no barcodes)
28000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus asiaticus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus brehmi
(no barcodes)
39000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus catus
(no barcodes)
34000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus (Corycaeus) clausi
(no barcodes)
546000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus (Corycaeus) crassiusculus
1048200
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus (Corycaeus) speciosus
2385400
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus (Ditrichocorycaeus) brehmi
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus dubius
(no barcodes)
35000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus flaccus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus giesbrechti
(no barcodes)
130000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus latus
(no barcodes)
216000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus lautus
(no barcodes)
152000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus longistylis
(no barcodes)
63000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus lubbocki
(no barcodes)
15000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus minimus
(no barcodes)
45000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus obtusus
(no barcodes)
12000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus ovalis
(no barcodes)
87000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus pacificus
(no barcodes)
27000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus pumilus
(no barcodes)
85000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus robustus
(no barcodes)
20000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus subtilis
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus subulatus
(no barcodes)
36000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus tenuis
(no barcodes)
12000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus (Urocorycaeus) furcifer
(no barcodes)
341000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Corycaeus : Corycaeus vitreus
(no barcodes)
20000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus affinis
(no barcodes)
1161000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus africanus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus amazonicus
(no barcodes)
218000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus americanus
(no barcodes)
11000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus andrewsi
563200
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus anglicus
2476951
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus asiaticus
(no barcodes)
540000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus aucklandicus
(no barcodes)
102000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus brehmi
(no barcodes)
83000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus dahli
(no barcodes)
747000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus erythraeus
(no barcodes)
501000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus lubbocki
(no barcodes)
432000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus minimus
(no barcodes)
61000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus subtilis
(no barcodes)
170000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Ditrichocorycaeus : Ditrichocorycaeus tenuis
(no barcodes)
31000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Farranula : Farranula carinata
(no barcodes)
344000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Farranula : Farranula concinna
(no barcodes)
991000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Farranula : Farranula curta
(no barcodes)
221000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Farranula : Farranula gibbula
1794300
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Farranula : Farranula gracilis
(no barcodes)
796000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Farranula : Farranula longicaudis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Farranula : Farranula rostrata
(no barcodes)
943000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Monocorycaeus : Monocorycaeus robustus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Onychocorycaeus : Onychocorycaeus agilis
(no barcodes)
549000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Onychocorycaeus : Onychocorycaeus catus
437200
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Onychocorycaeus : Onychocorycaeus giesbrechti
(no barcodes)
423000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Onychocorycaeus : Onychocorycaeus latus
(no barcodes)
269000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Onychocorycaeus : Onychocorycaeus ovalis
(no barcodes)
219000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Onychocorycaeus : Onychocorycaeus pacificus
(no barcodes)
631000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Onychocorycaeus : Onychocorycaeus pumilus
(no barcodes)
53000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Urocorycaeus : Urocorycaeus furcifer
(no barcodes)
322000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Urocorycaeus : Urocorycaeus lautus
(no barcodes)
232000
Crustacea - Copepoda : Cyclopoida : Corycaeidae : Urocorycaeus : Urocorycaeus longistylis
(no barcodes)
189000
Crustacea - Copepoda : Cyclopoida : Cyclopettidae : Cyclopetta : Cyclopetta boetiusae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopettidae : Limnoithona : Limnoithona sinensis
3111
Crustacea - Copepoda : Cyclopoida : Cyclopettidae : Paracyclopina : Paracyclopina longifurca
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Acanthocyclops : Acanthocyclops americanus
0787315
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Acanthocyclops : Acanthocyclops capillatus
0111
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Acanthocyclops : Acanthocyclops profundus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Acanthocyclops : Acanthocyclops robustus
011102
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Acanthocyclops : Acanthocyclops robustus : Acanthocyclops robustus robustus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Acanthocyclops : Acanthocyclops signifer
0200
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Acanthocyclops : Acanthocyclops vernalis
013124
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Acanthocyclops : Acanthocyclops vernalis : Acanthocyclops vernalis vernalis
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Ancheuryte : Ancheuryte notabilis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Apocyclops : Apocyclops borneoensis
0100
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Apocyclops : Apocyclops dimorphus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Apocyclops : Apocyclops panamensis
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Apocyclops : Apocyclops procerus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Apocyclops : Apocyclops ramkhamhaengi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Apocyclops : Apocyclops spartinus
0991
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Australocyclops : Australocyclops australis
0111
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops abyssorum
01294
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops bicuspidatus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops columbianus
0331
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops furcatus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops heberti
0111
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops insignis
01172
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops kikuchii
0100
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops kolensis
01422
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops ochridanus
0221
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops oithonoides
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops scutifer
0111
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops strenuus
2222
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Cyclops : Cyclops vicinus
0222
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Diacyclops : Diacyclops arenosus
0300
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Diacyclops : Diacyclops bicuspidatus
0211
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Diacyclops : Diacyclops elegans
0200
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Diacyclops : Diacyclops eulitoralis
0100
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Diacyclops : Diacyclops galbinus
0100
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Diacyclops : Diacyclops improcerus
0200
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Diacyclops : Diacyclops incolotaenia
0200
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Diacyclops : Diacyclops konstantini
0100
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Diacyclops : Diacyclops thomasi
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Diacyclops : Diacyclops zhimulevi
0200
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Ectocyclops : Ectocyclops phaleratus
0100
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Eucyclops : Eucyclops agilis
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Eucyclops : Eucyclops cuatrocienegas
0881
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Eucyclops : Eucyclops denticulatus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Eucyclops : Eucyclops macruroides
0221
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Eucyclops : Eucyclops macrurus
0551
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Eucyclops : Eucyclops prionophorus
0442
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Eucyclops : Eucyclops serrulatus
01073
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Eucyclops : Eucyclops speratus
0222
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Euryte : Euryte bellatula
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Euryte : Euryte verecunda
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops caneki
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops cenoticola
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops clarkei
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops coulli
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops crassicornis
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops dedeckeri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops exiguus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops fosteri
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops glaber
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops itohi
0100
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops laminifer
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops lutum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops magniceps
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops oraeeburnensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops ovatus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops reidae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops tetracanthus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops thermophilus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops venezuelaensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Halicyclops : Halicyclops ytororoma
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Macrocyclops : Macrocyclops albidus
016146
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Macrocyclops : Macrocyclops distinctus
0100
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Megacyclops : Megacyclops latipes
0111
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Megacyclops : Megacyclops viridis
0621
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Mesocyclops : Mesocyclops dissimilis
0211
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Mesocyclops : Mesocyclops edax
0222
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Mesocyclops : Mesocyclops leuckarti
0622
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Mesocyclops : Mesocyclops longisetus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Mesocyclops : Mesocyclops pehpeiensis
015132
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Mesocyclops : Mesocyclops thermocyclopoides
0211
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Metacyclops : Metacyclops mendocinus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Microcyclops : Microcyclops varicans
0211
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Neocyclops : Neocyclops australiensis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Neocyclops : Neocyclops ferrarii
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Neocyclops : Neocyclops medius
(no barcodes)
24000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Neocyclops : Neocyclops petkovskii
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Neocyclops : Neocyclops pilbarensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Neocyclops : Neocyclops sharkbayensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Neocyclops : Neocyclops trajani
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Neocyclops : Neocyclops tropicus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Neocyclops : Neocyclops vicinus
(no barcodes)
19000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Paracyclops : Paracyclops chiltoni
0211
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Paracyclops : Paracyclops fimbriatus
0200
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Prehendocyclops : Prehendocyclops abbreviatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Prehendocyclops : Prehendocyclops boxshalli
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Prehendocyclops : Prehendocyclops monchenkoi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Thermocyclops : Thermocyclops crassus
0211
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Thermocyclops : Thermocyclops decipiens
0111
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Thermocyclops : Thermocyclops inversus
062615
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Thermocyclops : Thermocyclops oithonoides
0100
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Thermocyclops : Thermocyclops taihokuensis
0111
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Tropocyclops : Tropocyclops ishidai
0100
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Tropocyclops : Tropocyclops parvus
0551
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Tropocyclops : Tropocyclops prasinus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopidae : Tropocyclops : Tropocyclops setulifer
0100
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Allocyclopina : Allocyclopina madagassica
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Arenocyclopina : Arenocyclopina biarticulata
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cryptocyclopina : Cryptocyclopina monchenkoi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina amita
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina brevifurca
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina caissara
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina caroli
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina gracilis
(no barcodes)
83000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina kasignete
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina littoralis
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina longicornis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina norvegica
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina rotundipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Cyclopina : Cyclopina schneideri
(no barcodes)
18000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Heptnerina : Heptnerina confusa
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Heterocyclopina : Heterocyclopina feiticeira
(no barcodes)
13000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Heterocyclopina : Heterocyclopina plesai
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopinidae : Heterocyclopina : Heterocyclopina uguaipuku
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Cyclopoida incertae sedis : Ophelicola : Ophelicola drachi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Cyclopoida incertae sedis : Ophelicola : Ophelicola kurambia
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Cyclopoida incertae sedis : Ruthra : Ruthra humesi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Enterognathidae : Gomphopodarion : Gomphopodarion byssoicum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Enteropsidae : Enterocola : Enterocola fulgens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Enteropsidae : Enterocola : Enterocola ianthina
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Enteropsidae : Enterocola : Enterocola parapterophorus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Enteropsidae : Enteropsis : Enteropsis georgianus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Enteropsidae : Enteropsis : Enteropsis roscoffensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Erebonasteridae : Ambilimbus : Ambilimbus altalis
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Erebonasteridae : Ambilimbus : Ambilimbus arcuscelestis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Erebonasteridae : Ambilimbus : Ambilimbus pacificus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Erebonasteridae : Ambilimbus : Ambilimbus tuerkayi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Erebonasteridae : Centobnaster : Centobnaster humesi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Erebonasteridae : Centobnaster : Centobnaster severnicus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Erebonasteridae : Erebonaster : Erebonaster protentipes
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Erebonasteridae : Nansennaster : Nansennaster innupta
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Dermoergasilus : Dermoergasilus acanthopagri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Dermoergasilus : Dermoergasilus intermedius
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus bani
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus caeruleus
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus caraguatatubensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus centrarchidarum
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus gibbus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus jaraquensis
0200
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus labracis
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus lizae
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus luciopercarum
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus manicatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus megaceros
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus mugilis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus sieboldi
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Ergasilus : Ergasilus wilsoni
0100
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Gamispinus : Gamispinus diabolicus
0200
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Mugilicola : Mugilicola smithae
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Neoergasilus : Neoergasilus japonicus
0100
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Paraergasilus : Paraergasilus acanthopagri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Ergasilidae : Therodamas : Therodamas dawsoni
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Giselinidae : Giselina : Giselina cristata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Giselinidae : Giselina : Giselina gerdesi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Giselinidae : Sensogiselina : Sensogiselina potteki
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Giselinidae : Sensogiselina : Sensogiselina reducta
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Hemicyclopinidae : Hemicyclopina : Hemicyclopina martinezi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Hemicyclopinidae : Monchenkiella : Monchenkiella lamellopinnata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Hemicyclopinidae : Neocyclopina : Neocyclopina langi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Hemicyclopinidae : Procyclopina : Procyclopina maricopeba
(no barcodes)
15000
Crustacea - Copepoda : Cyclopoida : Hemicyclopinidae : Procyclopina : Procyclopina polyarthra
(no barcodes)
16000
Crustacea - Copepoda : Cyclopoida : Hemicyclopinidae : Pseudocyclopina : Pseudocyclopina belgicae
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Herpyllobiidae : Eurysilenium : Eurysilenium oblongum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Herpyllobiidae : Herpyllobius : Herpyllobius hartmanae
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Herpyllobiidae : Herpyllobius : Herpyllobius polynoes
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Herpyllobiidae : Herpyllobius : Herpyllobius rotundus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Enalcyonium : Enalcyonium auriculatum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Enalcyonium : Enalcyonium bullatum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Enalcyonium : Enalcyonium caledonensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Enalcyonium : Enalcyonium carrikeri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Enalcyonium : Enalcyonium ceramensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Enalcyonium : Enalcyonium circulatum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Enalcyonium : Enalcyonium humesi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Enalcyonium : Enalcyonium olssoni
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Lamippe : Lamippe bouligandi
0800
Crustacea - Copepoda : Cyclopoida : Lamippidae : Lamippella : Lamippella acanellae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Linaresia : Linaresia bouligandi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lamippidae : Magnippe : Magnippe caputmedusae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Diogenella : Diogenella deichmannae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Diogenella : Diogenella impar
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Diogenidium : Diogenidium deforme
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Epimolgus : Epimolgus orientalis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Herrmannella : Herrmannella barneae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Herrmannella : Herrmannella bullata
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Herrmannella : Herrmannella columbiae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Herrmannella : Herrmannella dentata
0100
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Herrmannella : Herrmannella exigua
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Herrmannella : Herrmannella hoonsooi
0100
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Herrmannella : Herrmannella kodiakensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Herrmannella : Herrmannella saxidomi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Herrmannella : Herrmannella tivelae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgidium : Lichomolgidium tupuhiae
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus aegyptius
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus asaphidis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus canui
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus elegans
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus forficula
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus gigas
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus hippopi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus ieversi
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus indicus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus minor
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus rotundus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus similis
0100
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus tridacnae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus uncus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Lichomolgus : Lichomolgus vagans
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Modiolicola : Modiolicola bifida
0100
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Modiolicola : Modiolicola trabalis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Paclabius : Paclabius tumidus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Parastericola : Parastericola rimosus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola antheneae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola astrivagus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola caeruleus
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola curticaudatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola femineus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola flexilis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola holothuriae
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola illgi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola longicaudatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola novaecaledoniae
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola oreastriphilus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola parvulipes
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Stellicola : Stellicola pollex
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Synstellicola : Synstellicola acanthasteris
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Synstellicola : Synstellicola affinis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Synstellicola : Synstellicola carens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Synstellicola : Synstellicola gracilis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Synstellicola : Synstellicola kossmanni
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Synstellicola : Synstellicola longiseta
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Synstellicola : Synstellicola paracarens
1100
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Synstellicola : Synstellicola pichoni
(no barcodes)
11000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Synstellicola : Synstellicola thromidiae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Zygomolgus : Zygomolgus dentatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lichomolgidae : Zygomolgus : Zygomolgus didemni
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Atrophia : Atrophia glacialis
(no barcodes)
118000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Atrophia : Atrophia minuta
(no barcodes)
30000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Haplopodia : Haplopodia petersoni
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Homeognathia : Homeognathia brevis
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Homeognathia : Homeognathia flemingi
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Laitmatobius : Laitmatobius crinitus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Lubbockia : Lubbockia aculeata
(no barcodes)
122000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Lubbockia : Lubbockia brevis
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Lubbockia : Lubbockia glacialis
(no barcodes)
15000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Lubbockia : Lubbockia marukawai
(no barcodes)
16000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Lubbockia : Lubbockia squillimana
(no barcodes)
922000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Lubbockia : Lubbockia wilsonae
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Pseudolubbockia : Pseudolubbockia dilatata
(no barcodes)
13000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Rhamphochela : Rhamphochela carinata
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Lubbockiidae : Rhamphochela : Rhamphochela forcipula
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron angulare
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron avirostrum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron cheliferum
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron fucicolum
(no barcodes)
137000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron hudsoni
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron lobatum
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron longipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron lytocarpi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron rostratum
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron valgum
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Macrochiron : Macrochiron vervoorti
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Paramacrochiron : Paramacrochiron ennorense
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Paramacrochiron : Paramacrochiron japonicum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Paramacrochiron : Paramacrochiron maximum
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Paramacrochiron : Paramacrochiron pacificum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Paramacrochiron : Paramacrochiron rhizostomae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Paramacrochiron : Paramacrochiron sewelli
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Pseudomacrochiron : Pseudomacrochiron malayense
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Pseudomacrochiron : Pseudomacrochiron ornatum
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Macrochironidae : Pseudomacrochiron : Pseudomacrochiron parvum
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Mantridae : Nearchinotodelphys : Nearchinotodelphys indicus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Myicolidae : Crucisoma : Crucisoma bernardi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Myicolidae : Ostrincola : Ostrincola gracilis
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Myicolidae : Ostrincola : Ostrincola japonica
0100
Crustacea - Copepoda : Cyclopoida : Myicolidae : Ostrincola : Ostrincola patagonianus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Myicolidae : Pseudomyicola : Pseudomyicola spinosus
18521
Crustacea - Copepoda : Cyclopoida : Mytilicolidae : Mytilicola : Mytilicola intestinalis
92300
Crustacea - Copepoda : Cyclopoida : Mytilicolidae : Mytilicola : Mytilicola orientalis
492800
Crustacea - Copepoda : Cyclopoida : Nereicolidae : Pherma : Pherma curticaudatum
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Nereicolidae : Selioides : Selioides bocqueti
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Nereicolidae : Selioides : Selioides bolbroei
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Nereicolidae : Vectoriella : Vectoriella ramosae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Adenaplostoma : Adenaplostoma monniotorum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Bonnierilla : Bonnierilla curvicaudata
0300
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygella : Doropygella hastalae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygopsis : Doropygopsis longicauda
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus curvatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus demissus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus fernaldi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus globosus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus hummi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus laticornis
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus louisae
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus platythorax
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus pulex
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus rigidus
0100
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus schellenbergi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Doropygus : Doropygus seclusus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Gunenotophorus : Gunenotophorus blaizei
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Gunenotophorus : Gunenotophorus globularis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Lonchidiopsis : Lonchidiopsis hartmeyeri
0100
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Notodelphys : Notodelphys affinis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Notodelphys : Notodelphys allmani
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Notodelphys : Notodelphys canui
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Notodelphys : Notodelphys elegans
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Notodelphys : Notodelphys hatlassae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Notodelphys : Notodelphys monoseta
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Notodelphys : Notodelphys salthasae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Notodelphys : Notodelphys thalassae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Notopterophorus : Notopterophorus elatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Notopterophorus : Notopterophorus papilio
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Ophioseides : Ophioseides schellenbergi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Pachypygus : Pachypygus curvatus
0100
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Pachypygus : Pachypygus gibber
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Pygodelphys : Pygodelphys aquilonaris
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Pygodelphys : Pygodelphys novaeseelandius
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Pythodelphys : Pythodelphys illgi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Notodelphyidae : Scolecodes : Scolecodes huntsmani
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Octopicolidae : Octopicola : Octopicola regalis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Octopicolidae : Octopicola : Octopicola stocki
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Octopicolidae : Octopicola : Octopicola superba
(no barcodes)
0000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Dioithona : Dioithona oculata
(no barcodes)
85000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Dioithona : Dioithona rigida
891500
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona amazonica
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona aruensis
(no barcodes)
108000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona atlantica
(no barcodes)
5725000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona attenuata
930222
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona australis
(no barcodes)
23000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona bjornbergae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona brevicornis
(no barcodes)
1692000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona colcarva
(no barcodes)
11000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona davisae
86711101
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona decipiens
(no barcodes)
510000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona dissimilis
11994
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona fallax
(no barcodes)
501000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona flemingeri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona fonsecae
(no barcodes)
19000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona fragilis
(no barcodes)
15000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona frigida
20778995
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona hamata
(no barcodes)
161000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona hebes
(no barcodes)
297000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona helgolandica
(no barcodes)
221000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona linearis
(no barcodes)
63000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona longispina
(no barcodes)
230000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona minuta
(no barcodes)
181000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona nana
468411101
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona nishidai
(no barcodes)
45000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona oculata
0441
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona oswaldocruzi
(no barcodes)
119000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona parvula
(no barcodes)
174000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona plumifera
6540221
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona pseudofrigida
(no barcodes)
35000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona pseudovivida
(no barcodes)
56000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona pulla
(no barcodes)
45000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona robertsoni
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona robusta
(no barcodes)
477000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona rostralis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona setigera
(no barcodes)
5849000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona similis
5328324924433
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona simplex
18881071
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona spinirostris
(no barcodes)
114000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona tenuis
(no barcodes)
527000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona vivida
(no barcodes)
382000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Oithona : Oithona wellershausi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Paroithona : Paroithona parvula
(no barcodes)
174000
Crustacea - Copepoda : Cyclopoida : Oithonidae : Paroithona : Paroithona pulla
(no barcodes)
83000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Archioncaea : Archioncaea arabica
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Conaea : Conaea expressa
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Conaea : Conaea gracilis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Conaea : Conaea rapax
(no barcodes)
202000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Conaea : Conaea succurva
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Epicalymma : Epicalymma ancora
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Epicalymma : Epicalymma brittoni
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Epicalymma : Epicalymma exigua
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Epicalymma : Epicalymma schmitti
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Epicalymma : Epicalymma umbonata
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Epicalymma : Epicalymma vervoorti
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Monothula : Monothula subtilis
(no barcodes)
206000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea anglica
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea atlantica
(no barcodes)
19000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea bathyalis
(no barcodes)
110000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea borealis
(no barcodes)
127000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea bowmani
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea brocha
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea brodskii
(no barcodes)
33000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea clevei
(no barcodes)
1338000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea compacta
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea conifera
(no barcodes)
646000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea convexa
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea curta
508100
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea curvata
(no barcodes)
15447000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea damkaeri
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea delicata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea dentipes
(no barcodes)
313000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea englishi
(no barcodes)
15000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea frosti
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea glabra
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea gracilis
(no barcodes)
54000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea grossa
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea illgi
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea infantula
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea insolita
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea ivlevi
(no barcodes)
28000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea lacinia
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea longipes
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea longiseta
(no barcodes)
31000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea macilenta
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea media
4058300
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea mediterranea
1378222
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea memorata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea minuta
(no barcodes)
519000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea neobscura
(no barcodes)
24000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea notopus
(no barcodes)
374000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea obscura
(no barcodes)
116000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea obtusa
(no barcodes)
16000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea oceanica
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea olsoni
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea ornata
(no barcodes)
239000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea ovalis
(no barcodes)
156000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea parabathyalis
0111
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea paraclevei
(no barcodes)
53000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea parila
(no barcodes)
56000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea parobscura
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea petila
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea prendeli
20111
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea prolata
(no barcodes)
54000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea pumilis
(no barcodes)
21000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea rimula
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea rotata
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea rotunda
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea rotundata
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea scottodicarloi
193432
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea setosa
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea shmelevi
120111
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea similis
(no barcodes)
141000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea subtilis
(no barcodes)
205000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea tenella
(no barcodes)
86000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea tenuimana
(no barcodes)
28000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea tregoubovi
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea venusta
4516200
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea venusta : Oncaea venusta typica
906111
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea venusta : Oncaea venusta venella
(no barcodes)
381000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea vodjanitskii
(no barcodes)
16000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea waldemari
154332
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea walleni
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Oncaea : Oncaea zernovi
(no barcodes)
235000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia anglica
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia antarctica
(no barcodes)
37000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia borealis
(no barcodes)
3024000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia canadensis
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia conifera
2089221
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia denticula
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia dentipes
214111
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia derivata
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia elongata
12111
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia furcula
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia giesbrechti
(no barcodes)
25000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia hawii
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia inflexa
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia minuta
343331
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia parasimilis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia quadrata
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia redacta
(no barcodes)
17000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia rufa
(no barcodes)
17000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia similis
(no barcodes)
86000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia thoresoni
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Oncaeidae : Triconia : Triconia umerus
21221
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus belizensis
(no barcodes)
15000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus caribbei
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus cresseyi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus cribbi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus goodingi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus icopaius
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus lesteri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus mugilis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus mylionus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus nanus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus ornatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Colobomatus : Colobomatus sewelli
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philichthyidae : Philichthys : Philichthys xiphiae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philoblennidae : Briarella : Briarella risbeci
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Philoblennidae : Myzotheridion : Myzotheridion seguenziae
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Pionodesmotidae : Pionodesmotes : Pionodesmotes domhainfharraigeanus
0100
Crustacea - Copepoda : Cyclopoida : Polyankyliidae : Polyankylis : Polyankylis australis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Psammocyclopinidae : Metacyclopina : Metacyclopina brevisetosa
(no barcodes)
28000
Crustacea - Copepoda : Cyclopoida : Psammocyclopinidae : Metacyclopina : Metacyclopina harpacticoidea
0551
Crustacea - Copepoda : Cyclopoida : Psammocyclopinidae : Metacyclopina : Metacyclopina improvisa
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Mecomerinx : Mecomerinx heterocentroti
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Mecomerinx : Mecomerinx luculenta
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Mecomerinx : Mecomerinx notabilis
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Mecomerinx : Mecomerinx sewellana
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius brevicauda
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius comanthi
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius ferox
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius gracilis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius implanus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius madrasensis
(no barcodes)
13000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius major
(no barcodes)
13000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius minor
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius minutus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius mucronatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius newmanae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius obscurus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius pictus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius planus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius procurrens
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius pusillus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius rostellatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius truncus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius vinnulus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Pseudanthessius : Pseudanthessius weberi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Senariellus : Senariellus diadematis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Senariellus : Senariellus foliatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Senariellus : Senariellus latiseta
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Senariellus : Senariellus liber
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Senariellus : Senariellus tensus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Pseudaanthessiidae : Sipadania : Sipadania celerinae
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Pterinopsyllidae : Pterinopsyllotus : Pterinopsyllotus giesbrechti
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pterinopsyllidae : Pterinopsyllotus : Pterinopsyllotus illgi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Pterinopsyllidae : Pterinopsyllus : Pterinopsyllus giesbrechti
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus ambonensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus astrictus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus bandaensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus boholensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus brevifurca
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus cuneipes
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus eminulus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus exilipes
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus fissisetiger
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus geminus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus gentilis
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus gomumuensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus hales
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus hians
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus longiunguifer
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus plantei
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus pollicaris
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus telestophilus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus varirostratus
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Acanthomolgus : Acanthomolgus verseveldti
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Alcyonomolgus : Alcyonomolgus bicrenatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Alcyonomolgus : Alcyonomolgus dissimilis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Alcyonomolgus : Alcyonomolgus incisus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Alcyonomolgus : Alcyonomolgus insolens
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Alcyonomolgus : Alcyonomolgus lumellifer
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Alcyonomolgus : Alcyonomolgus petalophorus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Alcyonomolgus : Alcyonomolgus relativus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Alcyonomolgus : Alcyonomolgus sarcophyticus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Anisomolgus : Anisomolgus ensifer
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Anisomolgus : Anisomolgus goniodes
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Anisomolgus : Anisomolgus limbatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Anisomolgus : Anisomolgus protentus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Anisomolgus : Anisomolgus pterolobatus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Colobomolgus : Colobomolgus bandensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Colobomolgus : Colobomolgus cristatus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Colobomolgus : Colobomolgus dentipes
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Colobomolgus : Colobomolgus epaxius
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Contomolgus : Contomolgus lokobeensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus antennulus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus audens
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus brevicaudatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus caelatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus cladiellae
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus cylichnophorus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus dunnae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus foxi
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus gemmatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus linguifer
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus magnificus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus mandoensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus nudus
0100
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus orectopus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus paterellis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus penicillatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus rigidus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus scyphulanus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus titillans
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Critomolgus : Critomolgus vicinus
0100
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Diallagomolgus : Diallagomolgus productus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Diallagomolgus : Diallagomolgus vicinus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola aculeatus
(no barcodes)
11000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola agilis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola antheliae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola brevifurcatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola capnellae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola cincinnatus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola cinctus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola commodus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola comparatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola connexus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola echinasteris
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola hetaericus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola inaequalis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola inflatiseta
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola longicauda
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola lumarius
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola mimicus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola parvicaudatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola patulus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola petalopus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola praelongipes
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola rostripes
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola rumphellae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola securiger
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola sensilis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola similis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola simplex
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola singularipes
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola sunnivae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola venustus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Doridicola : Doridicola vulcanius
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Indomolgus : Indomolgus brevisetosus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Indomolgus : Indomolgus diversus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Indomolgus : Indomolgus humesi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Indomolgus : Indomolgus mutatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Isomolgus : Isomolgus desmotes
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Kombia : Kombia angulata
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Kombia : Kombia avitus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Kombia : Kombia imminens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Lambanetes : Lambanetes gemmulatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Lambanetes : Lambanetes stichodactylae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Lutumidomus : Lutumidomus panikkari
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Lutumidomus : Lutumidomus parvus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Mandobius : Mandobius regalis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Mecra : Mecra ellipsaria
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Meringomolgus : Meringomolgus devotus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Meringomolgus : Meringomolgus hamatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Moluccomolgus : Moluccomolgus lordus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Monomolgus : Monomolgus baculigerus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Monomolgus : Monomolgus psammocorae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Monomolgus : Monomolgus torulus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Monomolgus : Monomolgus unihastatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Notoxynus : Notoxynus crinitus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Notoxynus : Notoxynus mundus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Numboa : Numboa porosa
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Pachysericola : Pachysericola compressus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola adelphus
(no barcodes)
15000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola angularis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola contiguus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola drepanophorus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola glabripes
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola hystricosus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola robustus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola simulator
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola sinulariae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola squamiger
(no barcodes)
14000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola triquetrus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paradoridicola : Paradoridicola virgulifer
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus accinctus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus alcyoniicus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus ampullaceus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus anomalus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus centor
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus clavatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus constrictus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus dapsilis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus delicatulus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus ellisellae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus eniwetokensis
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus extendens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus galeatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus incidentus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus inconstans
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus insectus
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus litophyticus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus nephthaenus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus nudipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus pavonae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus politus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus pollicaris
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus promiculus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus quadrangulus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus resectus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus simulans
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus subincisus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paramolgus : Paramolgus timendus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Paredromolgus : Paredromolgus decorus
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Pennatulicola : Pennatulicola serratipes
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Perosyna : Perosyna indonesica
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Pionomolgus : Pionomolgus gallicolus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Pionomolgus : Pionomolgus moluccensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Plesiomolgus : Plesiomolgus conjunctus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Plesiomolgus : Plesiomolgus organicus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Ravahina : Ravahina tumida
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Rhynchomolgus : Rhynchomolgus corallophilus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Solitaricola : Solitaricola bipes
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Telestacicola : Telestacicola sertus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Temnomolgus : Temnomolgus eurynotus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Verutipes : Verutipes laticeps
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Verutipes : Verutipes scutatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Visayasia : Visayasia lobura
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Visayasia : Visayasia subterna
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Wedanus : Wedanus inconstans
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Xenomolgus : Xenomolgus varius
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Zamolgus : Zamolgus cavernularius
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Zamolgus : Zamolgus cracens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Rhynchomolgidae : Zamolgus : Zamolgus tridens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Acaenomolgus : Acaenomolgus gottoi
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Eupolymniphilus : Eupolymniphilus orientalis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Myxomolgus : Myxomolgus invulgus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Nasomolgus : Nasomolgus cristatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Nasomolgus : Nasomolgus firmus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Nasomolgus : Nasomolgus leptus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Nasomolgus : Nasomolgus parvulus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Nasomolgus : Nasomolgus rudis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Sabelliphilus : Sabelliphilus elongatus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Sabelliphilus : Sabelliphilus sarsi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Sabelliphilidae : Terebelliphilus : Terebelliphilus simplex
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Saccopsidae : Melinnacheres : Melinnacheres ergasiloides
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Saccopsidae : Melinnacheres : Melinnacheres steenstrupi
(no barcodes)
58000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Copilia : Copilia denticulata
(no barcodes)
64000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Copilia : Copilia hendorffi
(no barcodes)
33000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Copilia : Copilia lata
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Copilia : Copilia longistylis
(no barcodes)
80000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Copilia : Copilia mediterranea
(no barcodes)
157000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Copilia : Copilia mirabilis
1086911
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Copilia : Copilia quadrata
436200
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Copilia : Copilia recta
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Copilia : Copilia vitrea
(no barcodes)
128000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina angusta
273511
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina auronitens
131500
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina bicuspidata
(no barcodes)
36000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina darwinii
56100
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina gastrica
(no barcodes)
95000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina gemma
(no barcodes)
93000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina intestinata
(no barcodes)
56000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina iris
(no barcodes)
18000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina lactens
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina maculosa
(no barcodes)
41000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina metallina
2831044
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina nigromaculata
(no barcodes)
601000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina opalina
3201300
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina ovatolanceolata
(no barcodes)
144000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina pyrosomatis
(no barcodes)
23000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina sali
(no barcodes)
15000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina salpae
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina scarlata
233400
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina sinuicauda
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina stellata
182100
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Sapphirina : Sapphirina vorax
21100
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Vettoria : Vettoria granulosa
(no barcodes)
321000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Vettoria : Vettoria indica
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Sapphirinidae : Vettoria : Vettoria parva
(no barcodes)
131000
Crustacea - Copepoda : Cyclopoida : Schminkepinellidae : Barathricola : Barathricola rimensis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Schminkepinellidae : Cyclopinella : Cyclopinella tumidula
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Serpulidicolidae : Parangium : Parangium abstrusum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Serpulidicolidae : Rhynchopus : Rhynchopus catinatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Serpulidicolidae : Serpulidicola : Serpulidicola josephellae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Shiinoidae : Shiinoa : Shiinoa elagata
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Shiinoidae : Shiinoa : Shiinoa occlusa
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Smirnovipinidae : Cyclopinoides : Cyclopinoides littoralis
(no barcodes)
477000
Crustacea - Copepoda : Cyclopoida : Smirnovipinidae : Cyclopinoides : Cyclopinoides longicornis
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Smirnovipinidae : Smirnovipina : Smirnovipina barentsiana
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Speleoithonidae : Speleoithona : Speleoithona bermudensis
1100
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Ceratosomicola : Ceratosomicola mammilata
0100
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Ismaila : Ismaila aliena
0700
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Ismaila : Ismaila belciki
0100
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Ismaila : Ismaila chaihuiensis
0100
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Ismaila : Ismaila damnosa
0100
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Ismaila : Ismaila genalis
0100
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Ismaila : Ismaila robusta
0800
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Ismaila : Ismaila volatilis
0200
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Majimun : Majimun shirakawai
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Splanchnotrophus : Splanchnotrophus angulatus
01300
Crustacea - Copepoda : Cyclopoida : Splanchnotrophidae : Splanchnotrophus : Splanchnotrophus gracilis
0100
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Calypsarion : Calypsarion bilobatum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Chauliolobion : Chauliolobion bulbosum
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Chauliolobion : Chauliolobion forcipatum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Chauliolobion : Chauliolobion halodeimatis
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Chauliolobion : Chauliolobion imparile
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Chauliolobion : Chauliolobion tectuliferum
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Lecanurius : Lecanurius kossmannianus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Lecanurius : Lecanurius planifrontalis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Lichothuria : Lichothuria mandibularis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus batiolatus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus brachysetosus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus brevicaudus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus calcaratus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus campanulipes
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus idoneus
(no barcodes)
14000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus lobulatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus modestus
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus nicobaricus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus poculiferus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus robustus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus sentifer
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus serendibicus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus sewelli
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus subgrandis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus subtilis
(no barcodes)
22000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus tuberatus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Synapticolidae : Scambicornus : Scambicornus tylotus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Synaptiphilidae : Presynaptiphilus : Presynaptiphilus paraminutus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Anchistrotos : Anchistrotos kojimensis
0100
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Anchistrotos : Anchistrotos laqueus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Caudacanthus : Caudacanthus narcini
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Cirracanthus : Cirracanthus monacanthi
(no barcodes)
23000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Clavisodalis : Clavisodalis abbreviatus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Clavisodalis : Clavisodalis dilatatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Clavisodalis : Clavisodalis parvibullatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Clavisodalis : Clavisodalis salmacidis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Clavisodalis : Clavisodalis sentifer
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Clavisodalis : Clavisodalis tenuis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Echinosocius : Echinosocius gulicolus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Echinosocius : Echinosocius pectinatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Irodes : Irodes gracilis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Metataeniacanthus : Metataeniacanthus aquilonius
(no barcodes)
8000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Metataeniacanthus : Metataeniacanthus conepigri
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Metataeniacanthus : Metataeniacanthus epigri
(no barcodes)
16000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Metataeniacanthus : Metataeniacanthus gibbsi
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Metataeniacanthus : Metataeniacanthus indiscretus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Metataeniacanthus : Metataeniacanthus nudus
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Metataeniacanthus : Metataeniacanthus pacificus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Metataeniacanthus : Metataeniacanthus solidus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Metataeniacanthus : Metataeniacanthus synodi
(no barcodes)
17000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Metataeniacanthus : Metataeniacanthus vulgaris
(no barcodes)
18000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Nudisodalis : Nudisodalis acicula
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Pseudotaeniacanthus : Pseudotaeniacanthus congeri
0100
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthodes : Taeniacanthodes dojirii
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthodes : Taeniacanthodes gracilis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthodes : Taeniacanthodes haakeri
(no barcodes)
16000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus aluteri
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus balistae
(no barcodes)
9000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus brayae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus dentatus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus digitatus
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus fugu
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus glomerosus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus kiemae
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus lagocephali
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus larsonae
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus longicervis
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus mcgroutheri
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus moa
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus neopercis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus nudicauda
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus ostracionis
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus papulosus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus pectinatus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus pollicaris
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus rotundiceps
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus sauridae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus similis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus tetradonis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus thackerae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus williamsi
(no barcodes)
15000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniacanthus : Taeniacanthus yamagutii
0100
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Taeniastrotos : Taeniastrotos tragus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Taeniacanthidae : Tucca : Tucca impressus
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Thamnomolgidae : Forhania : Forhania philippinensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Thamnomolgidae : Thamnomolgus : Thamnomolgus nodulus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Thamnomolgidae : Thamnomolgus : Thamnomolgus robustus
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Thaumatopsyllidae : Caribeopsyllus : Caribeopsyllus amphiodiae
0100
Crustacea - Copepoda : Cyclopoida : Thaumatopsyllidae : Thaumatopsyllus : Thaumatopsyllus paradoxus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Urocopiidae : Urocopia : Urocopia deeveyae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Urocopiidae : Urocopia : Urocopia singularis
(no barcodes)
10000
Crustacea - Copepoda : Cyclopoida : Vahiniidae : Vahinius : Vahinius petax
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Vahiniidae : Vahinius : Vahinius verbericolus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Ventriculinidae : Heliogabalus : Heliogabalus phascolia
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Lipochrus : Lipochrus acroporinus
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia ablusa
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia acicularis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia anomala
(no barcodes)
6000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia anopla
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia basilica
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia breviramea
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia bullifera
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia clavellata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia comata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia comptula
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia curtata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia dissona
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia echinoporae
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia eminula
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia exserens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia exuta
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia fastigiata
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia filata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia fimbriata
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia finitima
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia fissilis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia formosa
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia gerlachi
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia gibberula
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia gracilipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia gradata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia guttulifera
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia hadra
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia heteromeles
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia imitans
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia imparilis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia infrequens
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia jugalis
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia lacerans
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia levis
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia maldivensis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia mediolobata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia minax
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia mucronata
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia obesa
(no barcodes)
3000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia pectinea
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia plectrata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia quinaria
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia radians
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia rasilis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia resex
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia rosariae
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia sabiuraensis
(no barcodes)
5000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia scutipes
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia sectilis
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia simplex
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia syntoma
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia temnura
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia torigera
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia trituberata
(no barcodes)
7000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia tumorisa
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia umbonata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia uncinata
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia varilabrata
(no barcodes)
4000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Xarifia : Xarifia villosa
(no barcodes)
1000
Crustacea - Copepoda : Cyclopoida : Xarifiidae : Zazaranus : Zazaranus fungicolus
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : Xenocoelomatidae : Xenocoeloma : Xenocoeloma alleni
(no barcodes)
2000
Crustacea - Copepoda : Cyclopoida : zzz incertae sedis : Pachos : Pachos dentatum
(no barcodes)
36000
Crustacea - Copepoda : Cyclopoida : zzz incertae sedis : Pachos : Pachos punctatum
74100
Crustacea - Copepoda : Cyclopoida : zzz incertae sedis : Pachos : Pachos tuberosum
(no barcodes)
5000









The Primer data below are a collaborative contribution of the ICES Working Group on Integrated Morphologocial and Molecular Taxonomy (WGIMT).

You can also download a CSV version of this compilation file (click here).

NOTE:   No primer data are currently available for this taxa level, but sibling primer data exist (below).

Sibling PRIMERS:   Below are primer data from any taxonomic-siblings of the current taxa.

Sibling Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Mesocyclops (T4003568) Nuclear 18S 18s329 Forward TAATGATCCTTCCGCAGGTT Spears et al. 1992 (L000119) ... 18sI- WGIMT-compilation 2016
Crustacea : Copepoda : Mesocyclops (T4003568) Nuclear 18S 18sI- Reverse AACT(CT)AAAGGAATTGACGG Spears et al. 1992 (L000119) ... 18s329 WGIMT-compilation 2016

Last Updated:   2020-May-12