Self PRIMERS:   Below are primers available for the current taxa entity (Neocalanus cristatus).

Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Neocalanus cristatus (T4000174) Mitochondrial cyt b Necr- CYB-L1 Forward TTGGTGGTGACTTGGTACAGTGG Machida et al. 2004 (L000108) ... WGIMT-compilation 2016