Self PRIMERS:   Below are primers available for the current taxa entity (Calanus helgolandicus).

Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Calanus helgolandicus (T4000145) Mitochondrial COI ChelgCOI-F Forward GGCCAAAACAGGGAGAGATA Papadopoulos et al. 2005 (L000115) ... ChelgCOI-R WGIMT-compilation 2016
Crustacea : Copepoda : Calanus helgolandicus (T4000145) Mitochondrial COI ChelgCOI-R Reverse CGGGACTCAGTATAATTATTCGTCTA Papadopoulos et al. 2005 (L000115) ... ChelgCOI-F WGIMT-compilation 2016