Molecular/Barcoding Data

This page is an in-development cooperative work with SCOR WG157 (MetaZooGene, MetaZooGene.org).   The "MZG" plots and information tables below summarize known observations of this taxa (Pleuromamma) and locations associated with GenBank barcodes for this taxa or taxa group (red stars).   Additional information on this taxa is available at  https://copepedia.org/?id=T4000078

Map Views:   [   World   |   Arctic   |   NATL   |   Mediterranean   |   SATL   |   NPAC   |   SPAC   |   Indian Ocean   |   Southern   ]



In the map above, light blue circles indicate where this taxa has been observed in COPEPOD or OBIS.
Red stars indicate locations where genus-level or species-level barcoding samples exist in GenBank or BOLD.




The table below shows the values plotted in the bargraph above.   Ocean columns indicate taxa has been observed in that ocean.

Sibling-taxa of this
Genus
# of Species
Observed in
COPEPOD/OBIS
# of Species
barcoded in
GenBank/BOLD
# of these
barcoded-species
with GeoLocation
Pleuromamma abdominalis111
Pleuromamma antarctica111
Pleuromamma borealis111
Pleuromamma gracilis111
Pleuromamma indica111
Pleuromamma johnsoni100
Pleuromamma piseki111
Pleuromamma quadrungulata100
Pleuromamma robusta111
Pleuromamma scutullata111
Pleuromamma xiphias111
GRAND TOTAL1199







The Primer data below are a collaborative contribution of the ICES Working Group on Integrated Morphologocial and Molecular Taxonomy (WGIMT).

You can also download a CSV version of this compilation file (click here).

Self PRIMERS:   Below are primers available for the current taxa entity (Pleuromamma).

Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Pleuromamma (T4000078) Mitochondrial COI PLXI_VH CCAAACGTTTCTTTCTTCCC Goetze 2011 (L000100) ... PLXI_VL WGIMT-compilation 2016
Crustacea : Copepoda : Pleuromamma (T4000078) Mitochondrial COI PLXI_VL TCAGCCAGGGTCTTTAATTGG Goetze 2011 (L000100) ... PLXI_VH WGIMT-compilation 2016

Last Updated:   2020-Nov-13