Molecular/Barcoding Data

This page is an in-development cooperative work with SCOR WG157 (MetaZooGene, MetaZooGene.org).   The "MZG" plots and information tables below summarize known observations of this taxa (Acartia) and locations associated with GenBank barcodes for this taxa or taxa group (red stars).   Additional information on this taxa is available at  https://copepedia.org/?id=T4000033

Map Views:   [   World   |   Arctic   |   NATL   |   Baltic   |   Mediterranean   |   SATL   |   NPAC   |   SPAC   |   Indian Ocean   |   Southern   ]



In the map above, light blue circles indicate where this taxa has been observed in COPEPOD or OBIS.
Red stars indicate locations where genus-level or species-level barcoding samples exist in GenBank or BOLD.




The table below shows the values plotted in the bargraph above.   Ocean columns indicate taxa has been observed in that ocean.

Sibling-taxa of this
Genus
# of Species
Observed in
COPEPOD/OBIS
# of Species
barcoded in
GenBank/BOLD
# of these
barcoded-species
with GeoLocation
Acartia (Acanthacartia)1584
Acartia (Acartia)220
Acartia (Acartiura)1287
Acartia (Euacartia)220
Acartia (Hypoacartia)100
Acartia japonica110
Acartia (Odontacartia)1054
Acartia pacifica111
GRAND TOTAL442716







The Primer data below are a collaborative contribution of the ICES Working Group on Integrated Morphologocial and Molecular Taxonomy (WGIMT).

You can also download a CSV version of this compilation file (click here).

Self PRIMERS:   Below are primers available for the current taxa entity (Acartia).

Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16S-167 Forward GACGAGAAGACCCTATGAAG Bucklin et al. 1998 (L000087) ... 16sbr-H WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16sbr-H Reverse CCGGTTTGAACTCAGATCATGT Palumbi 1996 (L000114) ... 16S-167 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 IST-5 Forward GGAAGTAAAAGTCGTAACAAGG White et al. 1990 (L000123) ... ITS-4 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 ITS-4 Reverse TCCTCCGCTTATTGATATGC White et al. 1990 (L000123) ... IST-5 WGIMT-compilation 2016

Last Updated:   2020-Nov-13