NOTE:   No primer data are currently available for this taxa level, but sibling primer data exist (below).

Sibling PRIMERS:   Below are primer data from any taxonomic-siblings of the current taxa.

Sibling Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Calanus helgolandicus (T4000145) Mitochondrial COI ChelgCOI-F Forward GGCCAAAACAGGGAGAGATA Papadopoulos et al. 2005 (L000115) ... ChelgCOI-R WGIMT-compilation 2016
Crustacea : Copepoda : Calanus helgolandicus (T4000145) Mitochondrial COI ChelgCOI-R Reverse CGGGACTCAGTATAATTATTCGTCTA Papadopoulos et al. 2005 (L000115) ... ChelgCOI-F WGIMT-compilation 2016