Molecular/Barcoding Data

This page is an in-development cooperative work with SCOR WG157 (MetaZooGene, MetaZooGene.org).   The "MZG" plots and information tables below summarize known observations of this taxa (Calanoida) and locations associated with GenBank barcodes for this taxa or taxa group (red stars).



In the map above, light blue circles indicate where this taxa has been observed in COPEPOD or OBIS.
Red stars indicate locations where genus-level or species-level barcoding samples exist in GenBank or BOLD.

COPEPEDIASpecies NameGenBank
Accessions
Unpublished
Barcodes
GenBank
Mapped Locations
GenBank
Missing-Locations
Unpublished
Mapped Locations
T4001126 Acartia (Odontacartia) amboinensis20100
T4000272 Acartia (Acanthacartia) bifilosa160190
T4003817 Acartia (Acanthacartia) bilobata10010
T4003818 Acartia (Odontacartia) bispinosa50050
T4003819 Acartia (Acanthacartia) californiensis3807280
T4003819 Acartia (Acanthacartia) californiensis3807280
T4000086 Acartia (Acartiura) clausi5508300
T4000086 Acartia (Acartiura) clausi5508300
T4000146 Acartia (Acartia) danae20020
T4003611 Acartia (Acartiura) discaudata100190
T4003821 Acartia (Acartiura) ensifera30100
T4000186 Acartia (Odontacartia) erythraea50140
T4003823 Acartia (Euacartia) forticrusa60060
T4003824 Acartia (Acanthacartia) fossae90200
T4003225 Acartia (Acartiura) hudsonica6801270
T4003225 Acartia (Acartiura) hudsonica6801270
T4003825 Acartia (Acartiura) jilletti10100
T4003826 Acartia (Acanthacartia) levequei10010
T4000163 Acartia (Acartiura) longiremis13001900
T4000163 Acartia (Acartiura) longiremis13001900
T4003612 Acartia (Acartiura) margalefi70070
T4000080 Acartia (Acartia) negligens80080
T4003827 Acartia (Odontacartia) ohtsukai70110
T4003820 Acartia (Acartiura) omorii20020
T4003687 Acartia (Odontacartia) pacifica150190
T4003828 Acartia (Euacartia) southwelli40040
T4000686 Acartia (Odontacartia) spinicauda30030
T4003829 Acartia (Acanthacartia) steueri30030
T4000739 Acartia (Acanthacartia) tonsa3760211970
T4000739 Acartia (Acanthacartia) tonsa3760211970
T4003227 Acartia (Acanthacartia) tsuensis80080
T4001363 Acrocalanus andersoni10100
T4000053 Acrocalanus gibber10100
T4000185 Acrocalanus gracilis10100
T4000231 Acrocalanus longicornis10100
T4000312 Acrocalanus monachus20110
T4001032 Aetideopsis carinata30100
T4001419 Aetideopsis minor90600
T4000829 Aetideopsis multiserrata10100
T4000863 Aetideopsis rostrata80400
T4000521 Aetideus acutus50050
T4000140 Aetideus armatus30300
T4000140 Aetideus armatus30300
T4001204 Aetideus bradyi20100
T4000440 Anomalocera patersoni240610
T4003876 Arctodiaptomus dorsalis260800
T4003876 Arctodiaptomus dorsalis260800
T4000670 Augaptilus glacialis10100
T4003830 Bathycalanus adornatus10100
T4003831 Bathycalanus bradyi40300
T4003832 Bathycalanus milleri10100
T4003833 Bathycalanus richardi20200
T4003834 Bathycalanus tumidus20100
T4003877 Bestiolina similis300830
T4003836 Bradycalanus enormis10100
T4000106 Calanoides acutus120310
T4000099 Calanoides carinatus6001140
T4001151 Calanoides macrocarinatus40110
T4000588 Calanopia thompsoni1100110
T4003632 Calanus agulhensis80080
T4003689 Calanus australis30110
T4003837 Calanus chilensis10010
T4003838 Calanus euxinus7000700
T4000005 Calanus finmarchicus4201030
T4000005 Calanus finmarchicus4201030
T4000170 Calanus glacialis102304130
T4000170 Calanus glacialis102304130
T4000145 Calanus helgolandicus10006320
T4000122 Calanus hyperboreus140580
T4000122 Calanus hyperboreus140580
T4001969 Calanus marshallae2201410
T4001969 Calanus marshallae2201410
T4003839 Calanus pacificus californicus10010
T4003840 Calanus pacificus oceanicus10010
T4000265 Calanus pacificus1901310
T4000265 Calanus pacificus1901310
T4000137 Calanus propinquus90300
T4000021 Calanus simillimus2701310
T4003223 Calanus sinicus3303300
T4000118 Calocalanus contractus30100
T4003842 Calocalanus curtus10100
T4003843 Calocalanus minutus10100
T4000042 Calocalanus pavo40310
T4000071 Calocalanus plumulosus20110
T4000134 Calocalanus styliremis20200
T4001724 Calocalanus tenuis20200
T4000378 Candacia bipinnata20110
T4000246 Candacia bispinosa30210
T4000311 Candacia bradyi10010
T4000282 Candacia catula50050
T4000300 Candacia curta30030
T4000802 Candacia discaudata10010
T4000717 Candacia ethiopica20020
T4000354 Candacia longimana10010
T4000217 Candacia pachydactyla20020
T4000264 Candacia simplex50400
T4000266 Candacia truncata60140
T4000098 Canthocalanus pauper40120
T4001972 Centropages abdominalis3601040
T4001972 Centropages abdominalis3601040
T4000375 Centropages bradyi10010
T4000306 Centropages chierchiae40100
T4000081 Centropages furcatus70070
T4000159 Centropages hamatus5201410
T4000159 Centropages hamatus5201410
T4000234 Centropages orsinii70130
T4000107 Centropages typicus1410111210
T4000107 Centropages typicus1410111210
T4000269 Centropages violaceus50200
T4001729 Chiridius armatus20020
T4000931 Chiridius gracilis10100
T4000491 Chiridius obtusifrons30300
T4000023 Clausocalanus arcuicornis5503460
T4000298 Clausocalanus brevipes30110
T4000784 Clausocalanus farrani20110
T4000062 Clausocalanus furcatus420450
T4000433 Clausocalanus ingens60310
T4000369 Clausocalanus jobei160440
T4000142 Clausocalanus laticeps50310
T4000379 Clausocalanus lividus4004340
T4000270 Clausocalanus mastigophorus50310
T4001193 Clausocalanus minor10010
T4000383 Clausocalanus parapergens190510
T4000110 Clausocalanus paululus50210
T4000161 Clausocalanus pergens120350
T4000069 Cosmocalanus darwinii50050
T4001418 Ctenocalanus citer60130
T4000022 Ctenocalanus vanus80310
T4003584 Diaixis hibernica20100
T4001244 Disseta palumbii50200
T4003847 Elenacalanus princeps90500
T4000716 Epilabidocera amphitrites30300
T4000716 Epilabidocera amphitrites30300
T4001451 Euaugaptilus laticeps20100
T4001177 Euaugaptilus magnus30200
T4000845 Euaugaptilus palumboi40200
T4000338 Eucalanus bungii20020
T4003439 Eucalanus californicus20020
T4000061 Eucalanus elongatus40040
T4001146 Eucalanus hyalinus1500150
T4000708 Eucalanus inermis20020
T4000351 Eucalanus pseudattenuatus20020
T4003848 Eucalanus spinifer1300130
T4000153 Eucalanus subtenuis30030
T4000296 Euchaeta acuta10100
T4000256 Euchaeta concinna1201110
T4000167 Euchaeta indica30030
T4000333 Euchaeta longicornis10010
T4000037 Euchaeta marina10010
T4000308 Euchaeta media60300
T4000897 Euchaeta plana30120
T4000432 Euchaeta rimana40040
T4000423 Euchirella amoena10100
T4001185 Euchirella bitumida10100
T4000478 Euchirella curticauda20200
T4000496 Euchirella messinensis30100
T4000466 Euchirella pulchra10100
T4000305 Euchirella rostrata20200
T4001085 Euchirella splendens10100
T4001051 Eudiaptomus graciloides80080
T4001121 Eurytemora affinis7120283810
T4001121 Eurytemora affinis7120283810
T4000629 Eurytemora herdmani5001000
T4000629 Eurytemora herdmani5001000
T4000415 Gaetanus brevispinus90600
T4000442 Gaetanus miles10100
T4000304 Gaetanus minor10100
T4001373 Gaetanus minutus10100
T4003638 Gaetanus tenuispinus70410
T4000109 Haloptilus longicornis40130
T4001103 Haloptilus ocellatus10100
T4000244 Heterorhabdus austrinus10100
T4000559 Heterorhabdus farrani10010
T4000363 Heterorhabdus norvegicus10100
T4003713 Heterorhabdus oikoumenikis10100
T4000116 Heterorhabdus papilliger60220
T4000372 Heterorhabdus spinifrons20200
T4000414 Heterostylites longicornis20110
T4000920 Heterostylites major10100
T4000680 Isias clavipes50100
T4000243 Labidocera acuta70160
T4000479 Labidocera detruncata20020
T4003692 Labidocera kroyeri50050
T4000302 Labidocera minuta60060
T4001340 Labidocera pavo20020
T4003850 Limnocalanus johanseni100400
T4003850 Limnocalanus johanseni100400
T4000212 Limnocalanus macrurus11608620
T4000632 Lophothrix humilifrons20200
T4000950 Lucicutia anomala10100
T4001870 Lucicutia aurita10100
T4000032 Lucicutia flavicornis40220
T4000840 Lucicutia polaris40200
T4000045 Mecynocera clausi60420
T4000045 Mecynocera clausi60420
T4003851 Megacalanus ericae120500
T4003852 Megacalanus frosti70300
T4000636 Megacalanus princeps40400
T4003854 Megacalanus typicus30200
T4000125 Mesocalanus tenuicornis130620
T4000125 Mesocalanus tenuicornis130620
T4001346 Mesorhabdus brevicaudatus10010
T4000789 Metridia effusa30200
T4000278 Metridia gerlachei110230
T4000114 Metridia longa130500
T4000114 Metridia longa130500
T4000029 Metridia lucens13803980
T4000029 Metridia lucens13803980
T4000166 Metridia pacifica330840
T4000166 Metridia pacifica330840
T4000855 Metridia venusta10100
T4000205 Microcalanus pusillus140600
T4001187 Mimocalanus crassus50200
T4001050 Mimocalanus cultrifer40200
T4003855 Mimocalanus damkaeri10100
T4003857 Mimocalanus heronae80200
T4003856 Mimocalanus nudus20100
T4000969 Monacilla typica70400
T4000025 Nannocalanus minor410640
T4000174 Neocalanus cristatus265062270
T4000174 Neocalanus cristatus265062270
T4003858 Neocalanus flemingeri13004390
T4000048 Neocalanus gracilis60220
T4000139 Neocalanus plumchrus10904300
T4000214 Neocalanus robustior1202100
T4001968 Neocalanus tonsus40110
T4001202 Nullosetigera impar10100
T4000041 Paracalanus aculeatus110420
T4000204 Paracalanus denudatus20200
T4003859 Paracalanus gracilis10010
T4000721 Paracalanus indicus6102110
T4000239 Paracalanus nanus50300
T4000031 Paracalanus parvus157029330
T4000031 Paracalanus parvus157029330
T4003366 Paracalanus quasimodo12801840
T4000740 Paracalanus tropicus3001100
T4003756 Paracartia grani1100110
T4003816 Paracartia latisetosa80080
T4000709 Paraeuchaeta antarctica100410
T4000980 Paraeuchaeta barbata50300
T4000249 Paraeuchaeta biloba40310
T4000373 Paraeuchaeta glacialis60420
T4000301 Paraeuchaeta hebes10100
T4000289 Paraeuchaeta norvegica1901040
T4000960 Paraeuchaeta polaris20200
T4001099 Paraeuchaeta rasa30200
T4003415 Paraeuchaeta rubra10100
T4000408 Paraheterorhabdus compactus80300
T4000992 Paraheterorhabdus robustus10100
T4001119 Paraugaptilus buchani20200
T4000044 Pareucalanus attenuatus30120
T4001371 Pareucalanus langae10010
T4003418 Pareucalanus parki10010
T4000796 Pareucalanus sewelli80170
T4003754 Parvocalanus crassirostris130560
T4003754 Parvocalanus crassirostris130560
T4000438 Phaenna spinifera10100
T4000047 Pleuromamma abdominalis98504980
T4000126 Pleuromamma borealis120420
T4000057 Pleuromamma gracilis460710
T4000100 Pleuromamma indica20200
T4000318 Pleuromamma piseki110400
T4000091 Pleuromamma robusta10100
T4001142 Pleuromamma scutullata10100
T4000172 Pleuromamma xiphias340033330
T4000164 Pontellina plumata100360
T4000645 Pontellopsis armata50050
T4000580 Pontellopsis perspicax10100
T4000556 Pontellopsis regalis10010
T4003427 Pseudocalanus acuspes365003650
T4000073 Pseudocalanus elongatus5706330
T4003428 Pseudocalanus mimus157021550
T4003428 Pseudocalanus mimus157021550
T4000210 Pseudocalanus minutus239022370
T4000210 Pseudocalanus minutus239022370
T4003860 Pseudocalanus moultoni6105500
T4003695 Pseudocalanus newmani279022730
T4003331 Pseudochirella obtusa20100
T4003233 Pseudodiaptomus marinus120380
T4003233 Pseudodiaptomus marinus120380
T4000307 Racovitzanus antarcticus10100
T4000079 Rhincalanus cornutus40130
T4000039 Rhincalanus gigas1701120
T4000058 Rhincalanus nasutus1602140
T4000854 Rhincalanus rostrifrons20020
T4003861 Rostrocalanus cognatus10100
T4001980 Scaphocalanus acrocephalus30200
T4000290 Scaphocalanus brevicornis20100
T4000743 Scaphocalanus brevirostris10100
T4000332 Scaphocalanus magnus10100
T4001352 Scaphocalanus major10100
T4000915 Scaphocalanus polaris10100
T4000390 Scolecithricella dentata30100
T4000221 Scolecithricella minor50310
T4000221 Scolecithricella minor50310
T4000213 Scolecithrix bradyi10100
T4000059 Scolecithrix danae40130
T4000631 Scottocalanus securifrons20100
T4003862 Sinocalanus sinensis70070
T4003235 Sinocalanus tenellus5402520
T4000313 Spinocalanus abyssalis20110
T4003863 Spinocalanus angusticeps10100
T4003864 Spinocalanus antarcticus50200
T4003865 Spinocalanus aspinosus50300
T4001186 Spinocalanus brevicaudatus120410
T4000806 Spinocalanus elongatus30100
T4003866 Spinocalanus hoplites40100
T4003691 Spinocalanus horridus100400
T4000353 Spinocalanus magnus130500
T4001362 Spinocalanus oligospinosus30200
T4003867 Spinocalanus similis20100
T4001049 Spinocalanus spinosus130410
T4003868 Spinocalanus stellatus30200
T4001361 Spinocalanus terranovae20100
T4003869 Spinocalanus usitatus20200
T4000864 Stephos longipes50110
T4000964 Subeucalanus crassus30030
T4003870 Subeucalanus longiceps10010
T4000329 Subeucalanus monachus30120
T4003728 Subeucalanus mucronatus30030
T4000277 Subeucalanus pileatus80260
T4000403 Subeucalanus subcrassus1400140
T4003644 Subeucalanus subtenuis40040
T4000128 Temora discaudata90270
T4000128 Temora discaudata90270
T4000084 Temora longicornis5901300
T4000084 Temora longicornis5901300
T4000095 Temora stylifera70250
T4000255 Temora turbinata80080
T4000463 Temorites brevis40200
T4000165 Temoropia mayumbaensis10100
T4000653 Tortanus discaudatus6201910
T4000653 Tortanus discaudatus6201910
T4003230 Tortanus forcipatus20020
T4003688 Tortanus (Tortanus) gracilis40040
T4000420 Undeuchaeta major30100
T4000895 Undinella oblonga10100
T4000056 Undinula vulgaris3908180
T4000056 Undinula vulgaris3908180






The Primer data below are a collaborative contribution of the ICES Working Group on Integrated Morphologocial and Molecular Taxonomy (WGIMT).

You can also download a CSV version of this compilation file (click here).

Self PRIMERS:   Below are primers available for the current taxa entity (Calanoida).

Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI H2612-COI Reverse AGGCCTAGGAAATGTATAGGGAAA Figueroa 2011 (L000096) ... L592-RCOI WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI L592-RCOI Forward AACCTTAATACATCTTTTTATGATG Figueroa 2011 (L000096) ... H2612-COI WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI LCO-1703 Forward CTATTTGATTGGAGGATTTGG Hill et al. 2001 (L000104) ... internal primer WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI LCO-1719 Forward GGATTTGGTAACTGATTAGTGCC Hill et al. 2001 (L000104) ... internal primer WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Nuclear 18S 18S-693R Reverse AAACCTCTGGCAAAACTACG Bucklin et al. 2003 (L000088) ... 18SE WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Nuclear 18S F1665-18S Forward CCGTCGCTACTACCGATTGAACG Machida (unpubl) in Figueroa 2011 (L000096) ... R73-5.8S WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Nuclear 18S R73-5.8S Reverse GTGTCGATGTTCATGTGTCCTGC Machida (unpubl) in Figueroa 2011 (L000096) ... F1665-18S WGIMT-compilation 2016

Sibling PRIMERS:   Below are primer data from any taxonomic-siblings of the current taxa.

Sibling Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Calanus helgolandicus (T4000145) Mitochondrial COI ChelgCOI-F Forward GGCCAAAACAGGGAGAGATA Papadopoulos et al. 2005 (L000115) ... ChelgCOI-R WGIMT-compilation 2016
Crustacea : Copepoda : Calanus helgolandicus (T4000145) Mitochondrial COI ChelgCOI-R Reverse CGGGACTCAGTATAATTATTCGTCTA Papadopoulos et al. 2005 (L000115) ... ChelgCOI-F WGIMT-compilation 2016
Crustacea : Copepoda : Neocalanus cristatus (T4000174) Mitochondrial cyt b Necr- CYB-L1 Forward TTGGTGGTGACTTGGTACAGTGG Machida et al. 2004 (L000108) ... WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial 16S 16SAR Forward CGCCTGTTTATCAAAAACAT Braga et al. 1999 (L000086) ... 16SCB WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial 16S 16SCB Reverse ATTCAACATCGAGGTCACAA Braga et al. 1999 (L000086) ... 16SAR WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial COI COI_RNI Forward GTAGT(AGCT)GTAAC(AT)GCTCATGC Goetze and Bradford-Grieve 2005 (L000101) ... COI_VH WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Nuclear ITS2 ITS10R Reverse TACGGGCCTATCACCCTCTACG Geerken and Wyngaard unpubl. Data in Goetze 2003 (L999999) ... ITS3F WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Nuclear ITS2 ITS3F Forward GCATCGATGAAGAACGCAGC White et al. 1990 (L000123) ... ITS10R WGIMT-compilation 2016
Crustacea : Copepoda : Pareucalanus (T4001906) Mitochondrial 16S 16S_PAR1 GCTAAGGTAGCATAATAATTAGTT Goetze 2003 (L000099) ... WGIMT-compilation 2016
Crustacea : Copepoda : Disseta (T4001938) Nuclear 28S F352-28S Forward AGACCGATAGTMAACAAGTACCGT Machida and Tsuda 2010 (L000109) ... WGIMT-compilation 2016
Crustacea : Copepoda : Disseta (T4001938) Nuclear 28S R768-28S Reverse TAGACTCCTTSGTCCGTGTTTCA Machida and Tsuda 2010 (L000109) ... WGIMT-compilation 2016
Crustacea : Copepoda : Paracalanidae (T4001255) Nuclear Histone H3 H3aF Forward ATGGCTCGTACCAAGCAGACVGC Colgan et al. 1998 (L000091) ... H3aR WGIMT-compilation 2016
Crustacea : Copepoda : Paracalanidae (T4001255) Nuclear Histone H3 H3aR Reverse ATATCCTTRGGCATRATRGTGAC Colgan et al. 1998 (L000091) ... H3aF WGIMT-compilation 2016
Crustacea : Copepoda : Subeucalanus (T4001900) Mitochondrial 16S 16S_SUB2 AAGTGCTAAGGTAGCATAAT Goetze 2003 (L000099) ... WGIMT-compilation 2016
Crustacea : Copepoda : Pleuromamma (T4000078) Mitochondrial COI PLXI_VH CCAAACGTTTCTTTCTTCCC Goetze 2011 (L000100) ... PLXI_VL WGIMT-compilation 2016
Crustacea : Copepoda : Pleuromamma (T4000078) Mitochondrial COI PLXI_VL TCAGCCAGGGTCTTTAATTGG Goetze 2011 (L000100) ... PLXI_VH WGIMT-compilation 2016
Crustacea : Copepoda : Clausocalanus (T4000087) Mitochondrial COI Forward GAGCCTGGTCAGGAATAATCG Blanco-Bercial and Alvarez-Marques 2007 (L000085) ... WGIMT-compilation 2016
Crustacea : Copepoda : Clausocalanus (T4000087) Mitochondrial COI Reverse GGTCTCCTCCTCCTCCAACAT Blanco-Bercial and Alvarez-Marques 2007 (L000085) ... WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16S-167 Forward GACGAGAAGACCCTATGAAG Bucklin et al. 1998 (L000087) ... 16sbr-H WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16sbr-H Reverse CCGGTTTGAACTCAGATCATGT Palumbi 1996 (L000114) ... 16S-167 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 IST-5 Forward GGAAGTAAAAGTCGTAACAAGG White et al. 1990 (L000123) ... ITS-4 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 ITS-4 Reverse TCCTCCGCTTATTGATATGC White et al. 1990 (L000123) ... IST-5 WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-1F Forward AACCTGGTTGATCCTGCCAGT Thum 2004 (L000120) ... 18S-1R WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-1R Reverse TGGTGCCCTTCCGTCAATTCCT Thum 2004 (L000120) ... 18S-1F WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-2F Forward CTGGTGCCAGCAGCCGCGG Thum 2004 (L000120) ... 18S-2R WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-2R Reverse TTGATCCTTCTGCAGGTTCACCTAC Thum 2004 (L000120) ... 18S-2F WGIMT-compilation 2016
Crustacea : Copepoda : Eurytemora (T4000082) Mitochondrial 16S 16SA2 Forward CCGGGT(CT)TCGCTAAGGTAG Lee 2000 (L000106) ... 16SB2 WGIMT-compilation 2016
Crustacea : Copepoda : Eurytemora (T4000082) Mitochondrial 16S 16SB2 Reverse CAACATCGAGGTCGCAGTAA Lee 2000 (L000106) ... 16SA2 WGIMT-compilation 2016