Self PRIMERS:   Below are primers available for the current taxa entity (Calanoida).

Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI H2612-COI Reverse AGGCCTAGGAAATGTATAGGGAAA Figueroa 2011 (L000096) ... L592-RCOI WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI L592-RCOI Forward AACCTTAATACATCTTTTTATGATG Figueroa 2011 (L000096) ... H2612-COI WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI LCO-1703 Forward CTATTTGATTGGAGGATTTGG Hill et al. 2001 (L000104) ... internal primer WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI LCO-1719 Forward GGATTTGGTAACTGATTAGTGCC Hill et al. 2001 (L000104) ... internal primer WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Nuclear 18S 18S-693R Reverse AAACCTCTGGCAAAACTACG Bucklin et al. 2003 (L000088) ... 18SE WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Nuclear 18S F1665-18S Forward CCGTCGCTACTACCGATTGAACG Machida (unpubl) in Figueroa 2011 (L000096) ... R73-5.8S WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Nuclear 18S R73-5.8S Reverse GTGTCGATGTTCATGTGTCCTGC Machida (unpubl) in Figueroa 2011 (L000096) ... F1665-18S WGIMT-compilation 2016

Sibling PRIMERS:   Below are primer data from any taxonomic-siblings of the current taxa.

Sibling Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Calanus helgolandicus (T4000145) Mitochondrial COI ChelgCOI-F Forward GGCCAAAACAGGGAGAGATA Papadopoulos et al. 2005 (L000115) ... ChelgCOI-R WGIMT-compilation 2016
Crustacea : Copepoda : Calanus helgolandicus (T4000145) Mitochondrial COI ChelgCOI-R Reverse CGGGACTCAGTATAATTATTCGTCTA Papadopoulos et al. 2005 (L000115) ... ChelgCOI-F WGIMT-compilation 2016
Crustacea : Copepoda : Neocalanus cristatus (T4000174) Mitochondrial cyt b Necr- CYB-L1 Forward TTGGTGGTGACTTGGTACAGTGG Machida et al. 2004 (L000108) ... WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial 16S 16SAR Forward CGCCTGTTTATCAAAAACAT Braga et al. 1999 (L000086) ... 16SCB WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial 16S 16SCB Reverse ATTCAACATCGAGGTCACAA Braga et al. 1999 (L000086) ... 16SAR WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial COI COI_RNI Forward GTAGT(AGCT)GTAAC(AT)GCTCATGC Goetze and Bradford-Grieve 2005 (L000101) ... COI_VH WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Nuclear ITS2 ITS10R Reverse TACGGGCCTATCACCCTCTACG Geerken and Wyngaard unpubl. Data in Goetze 2003 (L999999) ... ITS3F WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Nuclear ITS2 ITS3F Forward GCATCGATGAAGAACGCAGC White et al. 1990 (L000123) ... ITS10R WGIMT-compilation 2016
Crustacea : Copepoda : Pareucalanus (T4001906) Mitochondrial 16S 16S_PAR1 GCTAAGGTAGCATAATAATTAGTT Goetze 2003 (L000099) ... WGIMT-compilation 2016
Crustacea : Copepoda : Disseta (T4001938) Nuclear 28S F352-28S Forward AGACCGATAGTMAACAAGTACCGT Machida and Tsuda 2010 (L000109) ... WGIMT-compilation 2016
Crustacea : Copepoda : Disseta (T4001938) Nuclear 28S R768-28S Reverse TAGACTCCTTSGTCCGTGTTTCA Machida and Tsuda 2010 (L000109) ... WGIMT-compilation 2016
Crustacea : Copepoda : Paracalanidae (T4001255) Nuclear Histone H3 H3aF Forward ATGGCTCGTACCAAGCAGACVGC Colgan et al. 1998 (L000091) ... H3aR WGIMT-compilation 2016
Crustacea : Copepoda : Paracalanidae (T4001255) Nuclear Histone H3 H3aR Reverse ATATCCTTRGGCATRATRGTGAC Colgan et al. 1998 (L000091) ... H3aF WGIMT-compilation 2016
Crustacea : Copepoda : Subeucalanus (T4001900) Mitochondrial 16S 16S_SUB2 AAGTGCTAAGGTAGCATAAT Goetze 2003 (L000099) ... WGIMT-compilation 2016
Crustacea : Copepoda : Pleuromamma (T4000078) Mitochondrial COI PLXI_VH CCAAACGTTTCTTTCTTCCC Goetze 2011 (L000100) ... PLXI_VL WGIMT-compilation 2016
Crustacea : Copepoda : Pleuromamma (T4000078) Mitochondrial COI PLXI_VL TCAGCCAGGGTCTTTAATTGG Goetze 2011 (L000100) ... PLXI_VH WGIMT-compilation 2016
Crustacea : Copepoda : Clausocalanus (T4000087) Mitochondrial COI Forward GAGCCTGGTCAGGAATAATCG Blanco-Bercial and Alvarez-Marques 2007 (L000085) ... WGIMT-compilation 2016
Crustacea : Copepoda : Clausocalanus (T4000087) Mitochondrial COI Reverse GGTCTCCTCCTCCTCCAACAT Blanco-Bercial and Alvarez-Marques 2007 (L000085) ... WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16S-167 Forward GACGAGAAGACCCTATGAAG Bucklin et al. 1998 (L000087) ... 16sbr-H WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16sbr-H Reverse CCGGTTTGAACTCAGATCATGT Palumbi 1996 (L000114) ... 16S-167 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 IST-5 Forward GGAAGTAAAAGTCGTAACAAGG White et al. 1990 (L000123) ... ITS-4 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 ITS-4 Reverse TCCTCCGCTTATTGATATGC White et al. 1990 (L000123) ... IST-5 WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-1F Forward AACCTGGTTGATCCTGCCAGT Thum 2004 (L000120) ... 18S-1R WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-1R Reverse TGGTGCCCTTCCGTCAATTCCT Thum 2004 (L000120) ... 18S-1F WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-2F Forward CTGGTGCCAGCAGCCGCGG Thum 2004 (L000120) ... 18S-2R WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-2R Reverse TTGATCCTTCTGCAGGTTCACCTAC Thum 2004 (L000120) ... 18S-2F WGIMT-compilation 2016
Crustacea : Copepoda : Eurytemora (T4000082) Mitochondrial 16S 16SA2 Forward CCGGGT(CT)TCGCTAAGGTAG Lee 2000 (L000106) ... 16SB2 WGIMT-compilation 2016
Crustacea : Copepoda : Eurytemora (T4000082) Mitochondrial 16S 16SB2 Reverse CAACATCGAGGTCGCAGTAA Lee 2000 (L000106) ... 16SA2 WGIMT-compilation 2016