Molecular/Barcoding Data

This page is an in-development cooperative work with SCOR WG157 (MetaZooGene, MetaZooGene.org).   The "MZG" plots and information tables below summarize known observations of this taxa (Copepoda) and locations associated with GenBank barcodes for this taxa or taxa group (red stars).   Additional information on this taxa is available at  https://copepedia.org/?id=T4000001

Map Views:   [   World   |   Arctic   |   NATL   |   Baltic   |   Mediterranean   |   SATL   |   NPAC   |   SPAC   |   Indian Ocean   |   Southern   ]



In the map above, light blue circles indicate where this taxa has been observed in COPEPOD or OBIS.
Red stars indicate locations where genus-level or species-level barcoding samples exist in GenBank or BOLD.




The table below shows the values plotted in the bargraph above.   Ocean columns indicate taxa has been observed in that ocean.

Sibling-taxa of this
Subclass
# of Species
Observed in
COPEPOD/OBIS
# of Species
barcoded in
GenBank/BOLD
# of these
barcoded-species
with GeoLocation
Copepoda incertae sedis500
Neocopepoda4672958563
Progymnoplea110
GRAND TOTAL4678959563







The Primer data below are a collaborative contribution of the ICES Working Group on Integrated Morphologocial and Molecular Taxonomy (WGIMT).

You can also download a CSV version of this compilation file (click here).

NOTE:   No primer data are currently available for this taxa level, but sibling primer data exist (below).

Sibling PRIMERS:   Below are primer data from any taxonomic-siblings of the current taxa.

Sibling Taxonomic Entity Marker Primer Name Direction Sequence ( 5' - 3' ) Reference Primer Pairings Annealing T Compilation
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI H2612-COI Reverse AGGCCTAGGAAATGTATAGGGAAA Figueroa 2011 (L000096) ... L592-RCOI WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI L592-RCOI Forward AACCTTAATACATCTTTTTATGATG Figueroa 2011 (L000096) ... H2612-COI WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI LCO-1703 Forward CTATTTGATTGGAGGATTTGG Hill et al. 2001 (L000104) ... internal primer WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Mitochondrial COI LCO-1719 Forward GGATTTGGTAACTGATTAGTGCC Hill et al. 2001 (L000104) ... internal primer WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Nuclear 18S 18S-693R Reverse AAACCTCTGGCAAAACTACG Bucklin et al. 2003 (L000088) ... 18SE WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Nuclear 18S F1665-18S Forward CCGTCGCTACTACCGATTGAACG Machida (unpubl) in Figueroa 2011 (L000096) ... R73-5.8S WGIMT-compilation 2016
Crustacea : Copepoda : Calanoida (T4000002) Nuclear 18S R73-5.8S Reverse GTGTCGATGTTCATGTGTCCTGC Machida (unpubl) in Figueroa 2011 (L000096) ... F1665-18S WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16S-167 Forward GACGAGAAGACCCTATGAAG Bucklin et al. 1998 (L000087) ... 16sbr-H WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Mitochondrial 16S 16sbr-H Reverse CCGGTTTGAACTCAGATCATGT Palumbi 1996 (L000114) ... 16S-167 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 IST-5 Forward GGAAGTAAAAGTCGTAACAAGG White et al. 1990 (L000123) ... ITS-4 WGIMT-compilation 2016
Crustacea : Copepoda : Acartia (T4000033) Nuclear ITS2 ITS-4 Reverse TCCTCCGCTTATTGATATGC White et al. 1990 (L000123) ... IST-5 WGIMT-compilation 2016
Crustacea : Copepoda : Pleuromamma (T4000078) Mitochondrial COI PLXI_VH CCAAACGTTTCTTTCTTCCC Goetze 2011 (L000100) ... PLXI_VL WGIMT-compilation 2016
Crustacea : Copepoda : Pleuromamma (T4000078) Mitochondrial COI PLXI_VL TCAGCCAGGGTCTTTAATTGG Goetze 2011 (L000100) ... PLXI_VH WGIMT-compilation 2016
Crustacea : Copepoda : Eurytemora (T4000082) Mitochondrial 16S 16SA2 Forward CCGGGT(CT)TCGCTAAGGTAG Lee 2000 (L000106) ... 16SB2 WGIMT-compilation 2016
Crustacea : Copepoda : Eurytemora (T4000082) Mitochondrial 16S 16SB2 Reverse CAACATCGAGGTCGCAGTAA Lee 2000 (L000106) ... 16SA2 WGIMT-compilation 2016
Crustacea : Copepoda : Clausocalanus (T4000087) Mitochondrial COI Forward GAGCCTGGTCAGGAATAATCG Blanco-Bercial and Alvarez-Marques 2007 (L000085) ... WGIMT-compilation 2016
Crustacea : Copepoda : Clausocalanus (T4000087) Mitochondrial COI Reverse GGTCTCCTCCTCCTCCAACAT Blanco-Bercial and Alvarez-Marques 2007 (L000085) ... WGIMT-compilation 2016
Crustacea : Copepoda : Calanus helgolandicus (T4000145) Mitochondrial COI ChelgCOI-F Forward GGCCAAAACAGGGAGAGATA Papadopoulos et al. 2005 (L000115) ... ChelgCOI-R WGIMT-compilation 2016
Crustacea : Copepoda : Calanus helgolandicus (T4000145) Mitochondrial COI ChelgCOI-R Reverse CGGGACTCAGTATAATTATTCGTCTA Papadopoulos et al. 2005 (L000115) ... ChelgCOI-F WGIMT-compilation 2016
Crustacea : Copepoda : Neocalanus cristatus (T4000174) Mitochondrial cyt b Necr- CYB-L1 Forward TTGGTGGTGACTTGGTACAGTGG Machida et al. 2004 (L000108) ... WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial 16S 16SAR Forward CGCCTGTTTATCAAAAACAT Braga et al. 1999 (L000086) ... 16SCB WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial 16S 16SCB Reverse ATTCAACATCGAGGTCACAA Braga et al. 1999 (L000086) ... 16SAR WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Mitochondrial COI COI_RNI Forward GTAGT(AGCT)GTAAC(AT)GCTCATGC Goetze and Bradford-Grieve 2005 (L000101) ... COI_VH WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Nuclear ITS2 ITS10R Reverse TACGGGCCTATCACCCTCTACG Geerken and Wyngaard unpubl. Data in Goetze 2003 (L999999) ... ITS3F WGIMT-compilation 2016
Crustacea : Copepoda : Eucalanidae (T4000361) Nuclear ITS2 ITS3F Forward GCATCGATGAAGAACGCAGC White et al. 1990 (L000123) ... ITS10R WGIMT-compilation 2016
Crustacea : Copepoda : Paracalanidae (T4001255) Nuclear Histone H3 H3aF Forward ATGGCTCGTACCAAGCAGACVGC Colgan et al. 1998 (L000091) ... H3aR WGIMT-compilation 2016
Crustacea : Copepoda : Paracalanidae (T4001255) Nuclear Histone H3 H3aR Reverse ATATCCTTRGGCATRATRGTGAC Colgan et al. 1998 (L000091) ... H3aF WGIMT-compilation 2016
Crustacea : Copepoda : Subeucalanus (T4001900) Mitochondrial 16S 16S_SUB2 AAGTGCTAAGGTAGCATAAT Goetze 2003 (L000099) ... WGIMT-compilation 2016
Crustacea : Copepoda : Pareucalanus (T4001906) Mitochondrial 16S 16S_PAR1 GCTAAGGTAGCATAATAATTAGTT Goetze 2003 (L000099) ... WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-1F Forward AACCTGGTTGATCCTGCCAGT Thum 2004 (L000120) ... 18S-1R WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-1R Reverse TGGTGCCCTTCCGTCAATTCCT Thum 2004 (L000120) ... 18S-1F WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-2F Forward CTGGTGCCAGCAGCCGCGG Thum 2004 (L000120) ... 18S-2R WGIMT-compilation 2016
Crustacea : Copepoda : Diaptomidae (T4001908) Nuclear 18S 18S-2R Reverse TTGATCCTTCTGCAGGTTCACCTAC Thum 2004 (L000120) ... 18S-2F WGIMT-compilation 2016
Crustacea : Copepoda : Disseta (T4001938) Nuclear 28S F352-28S Forward AGACCGATAGTMAACAAGTACCGT Machida and Tsuda 2010 (L000109) ... WGIMT-compilation 2016
Crustacea : Copepoda : Disseta (T4001938) Nuclear 28S R768-28S Reverse TAGACTCCTTSGTCCGTGTTTCA Machida and Tsuda 2010 (L000109) ... WGIMT-compilation 2016
Crustacea : Copepoda : Mesocyclops (T4003568) Nuclear 18S 18s329 Forward TAATGATCCTTCCGCAGGTT Spears et al. 1992 (L000119) ... 18sI- WGIMT-compilation 2016
Crustacea : Copepoda : Mesocyclops (T4003568) Nuclear 18S 18sI- Reverse AACT(CT)AAAGGAATTGACGG Spears et al. 1992 (L000119) ... 18s329 WGIMT-compilation 2016

Last Updated:   2020-Nov-13