Search Results = All Markers (any type) &nbap;   (Download a CSV version of this table: primer-table-all.csv)

Taxon Marker Primer Name Direction Sequence (5'-3') Reference Primer Pairings
Various Marine Invertebrates : : Mitochondrial COI LCO-1490  Forward GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994 HCO2198 Nancy
Various Marine Invertebrates : : Mitochondrial COI HCO-2198  Reverse TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994 LCO1490
Various Marine Invertebrates : : Mitochondrial COI jgLCO1490  Forward TITCIACIAAYCAYAARGAYATTGG Geller et al. 2013 jgHCO2198
Various Marine Invertebrates : : Mitochondrial COI jgHCO2198  Reverse TAIACYTCIGGRTGICCRAARAAYCA Geller et al. 2013 gLCO1490
Various Marine Invertebrates : : Mitochondrial COI Nancy  Reverse CCCGGTAAAATTAAAATATAAACTTC Simon et al. 1994 LCO1490
Various Marine Invertebrates : : Mitochondrial cyt b UCYTB151F  Forward TGTGGRGCNACYGTWATYACTAA Merritt et al. 1998 UCYTB270R
Various Marine Invertebrates : : Mitochondrial cyt b UCYTB270R  Reverse AANAGGAARTAYCAYTCNGGYTG Merritt et al. 1998 UCYTB151F
Various Marine Invertebrates : : Nuclear 28S 28S-F1a  Forward GCGGAGGAAAAGAAACTAAC Ortman 2008 28S-R1a
Various Marine Invertebrates : : Nuclear 28S 28S-R1a  Reverse GCATAGTTTCACCATCTTTCGGG Ortman 2008 28S-F1a
Various Marine Invertebrates : : Nuclear 28S D9/10 Forward  Forward CGGCGGGAGTAACTATGACTCTCTTAAGGT Zardoya et al. 1995 D9/10 Reverse
Various Marine Invertebrates : : Nuclear 28S D9/10 Reverse  Reverse CCGCCCCAGCCAAACTCCCCA Zardoya et al. 1995 D9/10 Forward
Various Marine Invertebrates : : Nuclear 18S* 18A1 mod*  Forward CTGGTTGATCCTGCCAGTCATATGC Raupach et al. 2009 1800
Various Marine Invertebrates : : Nuclear 18S* 1800 mod*  Reverse GATCCTTCCGCAGGTTCACCTACG Raupach et al. 2009 18A1
Various Marine Invertebrates : : *internal Sequencing Primers F1  Forward AGCAGCCGCGGTAATTCCAGCT Laakmann et al. 2013
Various Marine Invertebrates : : *internal Sequencing Primers CF2  Forward GAAACTTAAAGGAATTGACGGAA Laakmann et al. 2013
Various Marine Invertebrates : : *internal Sequencing Primers CR1  Reverse CCTTCCGTCAATTCCTTTAAGT Laakmann et al. 2013
Various Marine Invertebrates : : *internal Sequencing Primers R2  Reverse AGCTGGAATTACCGCGGCTGCT Laakmann et al. 2013
Various Marine Invertebrates : : Nuclear 18S 18SE  Forward CTGGTTGATCCTGCCAGT Hillis and Dixon 1991 18SL
Various Marine Invertebrates : : Nuclear 18S 18SL  Reverse CACCTACGGAAACCTTGTTACGACTT Hamby and Zimmer 1988 18SE
Crustacea : Copepoda : Mitochondrial COI Cop-COI-2189R  Reverse GGGTGACCAAAAAATCARAA Bucklin et al. 2010a LCO1490
Crustacea : Copepoda : Mitochondrial COI Cop-COI-1498F  Forward AAYCATAAAGAYATYGGDAC Bucklin et al. 2010a HCO-2198
Crustacea : Copepoda : Mitochondrial COI Cop-COI-2105R  Reverse CGRTCHGTHARNARYATDGTAATDGC Bucklin et al. 2010a LCO1490
Crustacea : Copepoda : Mitochondrial COI Crus-COI-2198R  Reverse CCHACDGTAAAYATRTGRTG Bucklin et al. 2010a LCO1490
Crustacea : Copepoda : Mitochondrial COI Crus-COI-2428R  Reverse TTAATHCCHGTDGGNACVGCAAT Bucklin et al. 2010a LCO1490
Crustacea : Copepoda : Mitochondrial COI HCO-Co-2358  Reverse CCHACDGTAAAYATRTGRTG Bucklin et al. 2010b LCO1490
Crustacea : Copepoda : EucalanidaeMitochondrial COI COI_RNI  Forward GTAGT(AGCT)GTAAC(AT)GCTCATGC Goetze and Bradford-Grieve 2005 COI_VH
Crustacea : Copepoda : ClausocalanusMitochondrial COI   Forward GAGCCTGGTCAGGAATAATCG Blanco-Bercial and Alvarez-Marques 2007
Crustacea : Copepoda : ClausocalanusMitochondrial COI   Reverse GGTCTCCTCCTCCTCCAACAT Blanco-Bercial and Alvarez-Marques 2007
Crustacea : Copepoda : CalanoidaMitochondrial COI LCO-1703  Forward CTATTTGATTGGAGGATTTGG Hill et al. 2001 internal primer
Crustacea : Copepoda : CalanoidaMitochondrial COI LCO-1719  Forward GGATTTGGTAACTGATTAGTGCC Hill et al. 2001 internal primer
Crustacea : Copepoda : CalanoidaMitochondrial COI H2612-COI  Reverse AGGCCTAGGAAATGTATAGGGAAA Figueroa 2011 L592-RCOI
Crustacea : Copepoda : CalanoidaMitochondrial COI L592-RCOI  Forward AACCTTAATACATCTTTTTATGATG Figueroa 2011 H2612-COI
Crustacea : Copepoda : PleuromammaMitochondrial COI PLXI_VH    CCAAACGTTTCTTTCTTCCC Goetze 2011 PLXI_VL
Crustacea : Copepoda : PleuromammaMitochondrial COI PLXI_VL    TCAGCCAGGGTCTTTAATTGG Goetze 2011 PLXI_VH
Crustacea : Copepoda : Calanus helgolandicusMitochondrial COI ChelgCOI-F  Forward GGCCAAAACAGGGAGAGATA Papadopoulos et al. 2005 ChelgCOI-R
Crustacea : Copepoda : Calanus helgolandicusMitochondrial COI ChelgCOI-R  Reverse CGGGACTCAGTATAATTATTCGTCTA Papadopoulos et al. 2005 ChelgCOI-F
Crustacea : Copepoda : EucalanidaeMitochondrial 16S 16SAR  Forward CGCCTGTTTATCAAAAACAT Braga et al. 1999 16SCB
Crustacea : Copepoda : EucalanidaeMitochondrial 16S 16SCB  Reverse ATTCAACATCGAGGTCACAA Braga et al. 1999 16SAR
Crustacea : Copepoda : AcartiaMitochondrial 16S 16S-167  Forward GACGAGAAGACCCTATGAAG Bucklin et al. 1998 16sbr-H
Crustacea : Copepoda : AcartiaMitochondrial 16S 16sbr-H  Reverse CCGGTTTGAACTCAGATCATGT Palumbi 1996 16S-167
Crustacea : Copepoda : PareucalanusMitochondrial 16S 16S_PAR1    GCTAAGGTAGCATAATAATTAGTT Goetze 2003
Crustacea : Copepoda : SubeucalanusMitochondrial 16S 16S_SUB2    AAGTGCTAAGGTAGCATAAT Goetze 2003
Crustacea : Copepoda : EurytemoraMitochondrial 16S 16SA2  Forward CCGGGT(CT)TCGCTAAGGTAG Lee 2000 16SB2
Crustacea : Copepoda : EurytemoraMitochondrial 16S 16SB2  Reverse CAACATCGAGGTCGCAGTAA Lee 2000 16SA2
Crustacea : Copepoda : SkistodiaptomusMitochondrial 16S Skisto-1  Forward TGGTAAGGTAGCATAATAAT Thum and Harrison 2009 Skisto-2
Crustacea : Copepoda : SkistodiaptomusMitochondrial 16S Skisto-2  Reverse CCGGTTTGAACTCAGATCATGT Thum and Harrison 2009 Skisto-1
Crustacea : Copepoda : Calanidae EucalanidaeMitochondrial cyt b L10319-CYB  Forward CCTTGGGGKCAGATGTCTTTTTGGG Machida et al. 2004 H10648-CYB
Crustacea : Copepoda : Calanidae EucalanidaeMitochondrial cyt b H10648-CYB  Reverse GATAAAATTTTCWGGGTC Machida et al. 2004 L10319-CYB
Crustacea : Copepoda : Neocalanus cristatusMitochondrial cyt b Necr- CYB-L1  Forward TTGGTGGTGACTTGGTACAGTGG Machida et al. 2004
Crustacea : Copepoda : Oncaeids TigriopusMitochondrial 12S L13337-12S  Forward YCTACTWTGYTACGACTTATCTC Machida et al. 2002 H13842-12S
Crustacea : Copepoda : Oncaeids Eucalanidae CalanidaeMitochondrial 12S H13842-12S  Reverse TGTGCCAGCASCTGCGGTTAKAC Machida et al. 2004 L13337-12S
Crustacea : Copepoda : DissetaNuclear 28S F352-28S  Forward AGACCGATAGTMAACAAGTACCGT Machida and Tsuda 2010
Crustacea : Copepoda : DissetaNuclear 28S R768-28S  Reverse TAGACTCCTTSGTCCGTGTTTCA Machida and Tsuda 2010
Crustacea : Copepoda : CalanoidaNuclear 18S 18S-693R  Reverse AAACCTCTGGCAAAACTACG Bucklin et al. 2003 18SE
Crustacea : Copepoda : CalanoidaNuclear 18S F1665-18S  Forward CCGTCGCTACTACCGATTGAACG Machida (unpubl) in Figueroa 2011 R73-5.8S
Crustacea : Copepoda : CalanoidaNuclear 18S R73-5.8S  Reverse GTGTCGATGTTCATGTGTCCTGC Machida (unpubl) in Figueroa 2011 F1665-18S
Crustacea : Copepoda : DiaptomidaeNuclear 18S 18S-1F  Forward AACCTGGTTGATCCTGCCAGT Thum 2004 18S-1R
Crustacea : Copepoda : DiaptomidaeNuclear 18S 18S-1R  Reverse TGGTGCCCTTCCGTCAATTCCT Thum 2004 18S-1F
Crustacea : Copepoda : DiaptomidaeNuclear 18S 18S-2F  Forward CTGGTGCCAGCAGCCGCGG Thum 2004 18S-2R
Crustacea : Copepoda : DiaptomidaeNuclear 18S 18S-2R  Reverse TTGATCCTTCTGCAGGTTCACCTAC Thum 2004 18S-2F
Crustacea : Copepoda : MesocyclopsNuclear 18S 18s329  Forward TAATGATCCTTCCGCAGGTT Spears et al. 1992 18sI-
Crustacea : Copepoda : MesocyclopsNuclear 18S 18sI-  Reverse AACT(CT)AAAGGAATTGACGG Spears et al. 1992 18s329
Crustacea : Copepoda : EucalanidaeNuclear ITS2 ITS3F  Forward GCATCGATGAAGAACGCAGC White et al. 1990 ITS10R
Crustacea : Copepoda : EucalanidaeNuclear ITS2 ITS10R  Reverse TACGGGCCTATCACCCTCTACG Geerken and Wyngaard unpubl. Data in Goetze 2003 ITS3F
Crustacea : Copepoda : AcartiaNuclear ITS2 ITS-4  Reverse TCCTCCGCTTATTGATATGC White et al. 1990 IST-5
Crustacea : Copepoda : AcartiaNuclear ITS2 IST-5  Forward GGAAGTAAAAGTCGTAACAAGG White et al. 1990 ITS-4
Crustacea : Copepoda : ParacalanidaeNuclear Histone H3 H3aF  Forward ATGGCTCGTACCAAGCAGACVGC Colgan et al. 1998 H3aR
Crustacea : Copepoda : ParacalanidaeNuclear Histone H3 H3aR  Reverse ATATCCTTRGGCATRATRGTGAC Colgan et al. 1998 H3aF
Crustacea : Euphausiacea : Mitochondrial COI Eup-COI-2000R  Reverse CADACAAAYARWGGDATTCGGTCTAT Bucklin et al. 2010a LCO1490
Crustacea : Ostracoda : Mitochondrial COI Ost-COI-1535F  Forward GGDGCHTGAAGWGCWATGYTAGG Bucklin et al. 2010a HCO-2198
Crustacea : Decapoda : larvaeMitochondrial COI CrustF1  Forward TTTTCTACAAATCATAAAGACATTGG Costa et al. 2007 HCO2198
Crustacea : Decapoda : larvaeMitochondrial COI CrustF2  Forward GGTTCTTCTCCACCAACCACAARGAYATHGG Costa et al. 2007 HCO2198
Ctenophora : : Mitochondrial COI HCO-2424  Reverse TTAATACCTGTAGGAACGGCAATAATTAT Ortman 2008 LCO1490
Cnidaria : Hydrozoa : Mitochondrial COI MedCOIR  Reverse GGAACTGCTATAATCATAGTTGC Ortman et al. 2010 LCO1490
Cnidaria : Hydrozoa : Mitochondrial COI HCO-2607  Reverse ACATAGTGGAAATGTGCTACAACATA Ortman 2008 LCO1490
Cnidaria : Hydrozoa : Mitochondrial 16S SHA    ACGGAATGAACTCAAATCATGT Cunningham and Buss 1993 SHB
Cnidaria : Hydrozoa : Mitochondrial 16S SHB    TCGACTGTTTACCAAAAACATA Cunningham and Buss 1993 SHA
Cnidaria : Hydrozoa : Mitochondrial 16S F2    TCGACTGTTTACCAAAAACATAGC Cunningham and Buss 1993 R2
Cnidaria : Hydrozoa : Mitochondrial 16S R2    ACGGAATGAACTCAAATCATGTAAG Cunningham and Buss 1993 F2
Cnidaria : Scyphozoa : Mitochondrial COI LCOjf  Forward GGTCAACAAATCATAAAGATATTGGAAC Dawson 2005 HCO2198
Cnidaria : Scyphozoa : Mitochondrial COI HCOcato  Reverse CCTCCAGCAGGATCAAAGAAAG Dawson 2005 LCOjf
Cnidaria : Scyphozoa : Nuclear 28S Aa L28S_21  Forward GAACRGCTCAAGCTTRAAATCT Bayha et al. 2010 Aa_H28S_1078
Cnidaria : Scyphozoa : Nuclear 28S Aa_H28S_1078  Reverse GAAACTTCGGAGGGAACCAGCTAC Bayha et al. 2010 Aa L28S_21
Cnidaria : Scyphozoa : Nuclear ITS1 jfITS1-5f  Forward GGTTTCCGTAGGTGAACCTGCGGAAGGATC Dawson and Jacobs 2001 jfITS1-3r
Cnidaria : Scyphozoa : Nuclear ITS1 jfITS1-3r  Reverse CGCACGAGCCGAGTGATCCACCTTAGAAG Dawson and Jacobs 2001 jfITS1-5f
Cnidaria : Scyphozoa : Aurelia spp.Mitochondrial COI L5    CTCTTGTAAGGTGAAGCC Schroth et al. 2002 H5
Cnidaria : Scyphozoa : Aurelia spp.Mitochondrial COI H5    CATAATTCAACATCGAGG Schroth et al. 2002 L5
Pisces (Ichtyoplankton) : : Mitochondrial COI FishF1  Forward TCAACCAACCACAAAGACATTGGCAC Ward et al. 2005 FishR1
Pisces (Ichtyoplankton) : : Mitochondrial COI FishF2  Forward TCGACTAATCATAAAGATATCGGCAC Ward et al. 2005 FishR2
Pisces (Ichtyoplankton) : : Mitochondrial COI FishR1  Reverse TAGACTTCTGGGTGGCCAAAGAATCA Ward et al. 2005 FishF1
Pisces (Ichtyoplankton) : : Mitochondrial COI FishR2  Reverse ACTTCAGGGTGACCGAAGAATCAGAA Ward et al. 2005 FishF2
Mollusca Gastropoda : : Mitochondrial COI dgLCO-1490  Forward GGTCAACAAATCATAAAGAYATYGG Meyer 2003 dgHCO-2198
Mollusca Gastropoda : : Mitochondrial COI dgHCO-2198  Reverse TAAACTTCAGGGTGACCAAARAAYCA Meyer 2003 dgLCO-1490
Crustacea : Decapoda : Mitochondrial COI COL6  Forward TYTCHACAAAYCATAAAGAYATYGG Schubart (2009) COH6
Crustacea : Decapoda : Mitochondrial COI COL8  Forward GAYCAAATACCTTTATTTGT Schubart (2009) COH6 ; COH1b
Crustacea : Decapoda : Mitochondrial COI COL1b  Forward CCWGCTGGDGGWGGDGAYCC Schubart (2009) COH1b
Crustacea : Decapoda : Mitochondrial COI COH6  Reverse TADACTTCDGGRTGDCCAAARAAYCA Schubart & Huber (2006) COL6 ; COL1b
Crustacea : Decapoda : Mitochondrial COI COH1b  Reverse TGTATARGCRTCTGGRTARTC Schubart (2009) Lobo F1 ; COL6
Crustacea : Decapoda : Mitochondrial 16S 16L2  Forward TGCCTGTTTATCAAAAACAT Schubart (2002) 16H2 ; 16HLeu
Crustacea : Decapoda : Mitochondrial 16S 16L29  Forward YGCCTGTTTATCAAAAACAT Schubart et al. (2001) as 16L2 16H2 ; 16HLeu
Crustacea : Decapoda : Mitochondrial 16S 16HLeu  Reverse CATATTATCTGCCAAAATAG Schubart (2009) 16L2
Crustacea : Decapoda : Mitochondrial 16S 16H11  Reverse AGATAGAAACCRACCTGG' Schubart (2009) 16L2
Crustacea : Decapoda : Mitochondrial 16S 16H2  Reverse AGATAGAAACCAACCTGG Schubart et al. (2000) 16L2
Various Marine Invertebrates : : Mitochondrial COI (barcode enhanced primers) Lobo F1  Forward KBTCHACAAAYCAYAARGAYATHGG Lobo et al. (2013) BMC Ecology 13:34 Lobo R1
Various Marine Invertebrates : : Mitochondrial COI (barcode enhanced primers) Lobo R1  Reverse TGRTTYTTYGGWCAYCCWGARGTTTA Lobo et al. (2013) BMC Ecology 13:34 Lobo F1


Primers for Amplificatoin and Sequencing:

  • Bayha KM, Dawson MN, Collins AG, Barbeitos MS, Haddock SHD (2010) Evolutionary relationships among scyphozoan jellyfish families based on complete taxon sampling and phylogenetic analyses of 18S and 28S ribosomal DNA. Integrative and Comparative Biology 50:436-455.,

  • Blanco-Bercial L, A?lvarez-Marque?s F (2007) RFLP procedure to discriminate betwee Clausocalanus Giesbrecht, 1888 (Copepoda, Calanoida) species in the Central Cantabrian Sea. Journal of Experimental Marine Biology and Ecology 344: 73-77.,

  • Braga E, Zardoya R, Meyer A, Yen J (1999) Mitochondrial and nuclear rRNA based copepod phylogeny with emphasis on the Euchaetidae (Calanoida). Marine Biology 133:79-90.,

  • Bucklin A, Caudill CC, Bentley AM (1998) Population genetics and phylogeny of marine planktonic copepods. In Cooksey KC (ed.), Molecular Approaches to the Study of the Ocean. Chapman Hall, London: 303-318.,

  • Bucklin A, Frost BW, Bradford-Grieve J, Allen LD, Copley NJ (2003) Molecular systematic and phylogenetic assessment of 34 calanoid copepod species of the Calanidae and Clausocalanidae. Marine Biology 142: 333-343.,

  • Bucklin A, Ortman BD, Jennings RM, Nigro LM, Sweetman CJ, Copley NJ, Sutton T, Wiebe PH (2010a) A Rosetta Stone for metazoan zooplankton: DNA barcode analysis of species diversity in the Sargasso Sea (Northwest Atlantic Ocean). Deep-Sea Research II 57:2234-2247.,

  • Bucklin A, Hopcroft RR, Kosobokova KN, Nigro LM, Ortman BD, Jennings RM, Sweetman CJ (2010b) DNA barcoding of Arctic Ocean holozooplankton for species identification and recognition. Deep Sea Research Part II 57:40-48.,

  • Colgan DJ, McLauchlan A, Wilson GDF, Livingston SP, Edgecombe GD, Macaranas J, Cassis G, Gray MR (1998) Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46: 419-437.,

  • Costa FO, deWaard JR, Boutillier J, Ratnasinghamn S, Dooh RT, Hajibabaei M, Hebert PDN (2007) Biological identifications through DNA barcodes: the case of the Crustacea. Canadian Journal of Fisheries and Aquatic Sciences 64:272-295.,

  • Cunningham CW, Buss L W (1993) Molecular evidence for multiple episodes of pedomorphosis in the family Hydractiniidae. Biochemical Systematics and Ecology 21: 57-69.,

  • Dawson MN (2005) Incipient speciation of Catostylus mosaicus (Scyphozoa, Rhizostomeae, Catostylidae), comparative phylogeography, and biogeography in south-eastern Australia. Journal of Biogeography 32: 515-533,

  • Dawson MN, Jacobs DK (2001) Molecular evidence for cryptic species of Aurelia aurita (Cnidaria, Scyphozoa). Biological Bulletin 200:92-96.,

  • Figueroa DF (2011) Phylogenetic Analysis of Ridgewayia (Copepoda: Calanoida) from the Galapagos and of a new species from the Florida Keys with a reevaluation of the phylogeny of Calanoida. Journal of Crustacean Biology 31: 153 - 165.,

  • Folmer OM, Black W, Hoen R, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299.,

  • Geller J, Meyer C, Parker M, Hawk H (2013) Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys. Molecular Ecology Resources doi: 10.1111/1755-0998.12138,

  • Goetze E (2003) Cryptic speciation on the high seas; global phylogenetics of the copepod family Eucalanidae. Proceedings of the Royal Society of London, Series B: Biological Sciences 270:2321-2331.,

  • Goetze E (2011) Population Differentiation in the Open Sea: Insights from the Pelagic Copepod Pleuromamma xiphias. Integrative and Comparative Biology 51: 580 - 597.,

  • Goetze E, Bradford-Grieve J (2005) Genetic and morphological description of Eucalanus spinifer T. Scott, 1894 (Calanoida: Eucalanidae), a circumglobal sister pecies of the copepod E. hyalinus s.s. (Claus, 1866). Progress in Oceanography 65: 55 - 87.,

  • Hamby RK, Zimmer EA (1988) Ribosomal RNA sequences for inferring phylogeny within the grass family (Poaceae). Plant Systematics and Evolution 160:29-37.,

  • Hill RS, Allen LD, Bucklin A (2001) Multiplexed species-specific PCR protocol to discriminate four N. Atlantic Calanus species, with an mtCOI gene tree for ten Calanus species. Marine Biology 139: 279 - 287.,

  • Hillis DM, Dixon MT (1991) Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology 66:411-453,

  • Laakmann S, Gerdts G, Erler R, Knebelsberger T, Martinez Arbizu P, Raupach MJ (2013) Comparison of molecular species identification for North Sea calanoid copepods (Crustacea) using proteome fingerprints and DNA sequences. Molecular Ecology Resources doi: 10.1111/1755-0998.12139,

  • Lee CE (2000) Global phylogeography of a cryptic copepod species complex and reproductive isolation between genetically proximate "populations". Evolution 54: 2014-2027.,

  • Machida RJ, Tsuda A (2010) Dissimilarity of species and forms of planktonic Neocalanus copepods using mitochondrial COI, 12S, nuclear ITS, and 28S gene sequences. PLoS ONE 5:e10278. doi:10210.11371/journal.pone.0010278,

  • Machida RJ, Miya MU, Nishida M, Nishida S (2002) Complete mitochondrial DNA sequence of Tigriopus japonicus (Crustacea: Copepoda). Marine Biotechnology 4: 406-417.,

  • Machida RJ, Miya MU, Nishida M, Nishida S (2004) Large-scale gene rearrangements in the mitochondrial genomes of two calanoid copepods Eucalanus bungii and Neocalanus cristatus (Crustacea), with notes on new versatile primers for the srRNA and COI genes. Gene 332: 71-78.,

  • Merrit TJS, Shi L, Chase MC, Rex MA, Etter RJ (1998) Universal cytochrome b primers facilitate intraspecific studies in molluscan taxa. Molecular Marine Biology and Biotechnology 7:7-11,

  • Meyer CP (2003) Molecular systematics of cowries (Gastropoda: Cypraeidae) and diversification patterns in the tropics. Biological Journal of the Linnean Society 79:401-459,

  • Ortman BD (2008) DNA Barcoding the Medusozoa and Ctenophora. Disseration, University of Connecticut, Storrs, CT 121pp.,

  • Ortman BD, Bucklin A, Pages F, Youngbluth M (2010) DNA Barcoding the Medusozoa using mtCOI. Deep Sea Research Part II 57:2148-2156.,

  • Palumbi SR (1996) Nucleic acids II. The polymerase chain re- action. In Hillis DM, Moritz C,. Mable BK (eds), Molecular Systematics, 2nd edn. Sinauer Assoc., Sunderland, MA: 205-247.,

  • Papadopoulos LN, Peijnenburg KTCA, Luttikhuizen PC (2005) Phylogeography of the calanoid copepods Calanus helgolandicus and C. euxinus suggests Pleistocene divergences between Atlantic, Mediterranean, and Black Sea populations. Marine Biology 147: 1353-1365,

  • Raupach MJ, Mayer C, Malyutina M, Wegele J-W (2009) Multiple origins of deep-sea Asellota (Crustacea: Isopoda) from shallow waters revealed by molecular data. Proceedings of the Royal Society of London, Series B: Biological Sciences 276:799-808.,

  • Schroth W, Jarms G, Streit B, Schierwater B (2002) Speciation and phylogeography in the cosmopolitan marine moon jelly, Aurelia sp. BMC Evolutionary Biology 2:1-10.,

  • Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved PCR primers. Annals of the Entomological Society of America 87:651-701.,

  • Spears T, Abele LG, Kim W (1992) The monophyly of brachyuran crabs: a phylogenetic study based on 18S rRNA. Systematic Biology 41: 446-461.,

  • Thum RA (2004) Using 18S rDNA to resolve diaptomid copepod (Copepoda: Calanoida: Diaptomidae) phylogeny: an example with the North American genera. Hydrobiologia 519, 135-141.,

  • Thum RA, Harrison RG (2009) Deep genetic divergences among morphologically similar and parapatric Skistodiaptomus (Copepoda: Calanoida: Diaptomidae) challenge the hypothesis of Pleistocene speciation. Biological Journal of the Linnean Society 96, 150-165.,

  • Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PS (2005) DNA Barcoding of Australia's fish species. Philosophical Transactions of the Royal Society B: Biological Sciences 360:1847-1857.,

  • White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ (Eds), PCR Protocols. Academic Press, New York, pp 315-322.,

  • Zardoya R, Costas E, Lopez-Rodas V, Garrido-Pertierra A, Bautista JM (1995) Revised dinoflagellate phylogeny inferred from molecular analysis of large-subunit ribosomal RNA gene sequences. Journal of Molecular Evolution 41:637-645.,

Barcode Of Life .net : (LINK - click here)


< br>